Incidental Mutation 'R2368:Vstm5'
ID246402
Institutional Source Beutler Lab
Gene Symbol Vstm5
Ensembl Gene ENSMUSG00000031937
Gene NameV-set and transmembrane domain containing 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2368 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15239045-15259416 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15257731 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 166 (M166L)
Ref Sequence ENSEMBL: ENSMUSP00000034413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034411] [ENSMUST00000034413] [ENSMUST00000213788]
Predicted Effect probably benign
Transcript: ENSMUST00000034411
SMART Domains Protein: ENSMUSP00000034411
Gene: ENSMUSG00000031935

DomainStartEndE-ValueType
low complexity region 51 82 N/A INTRINSIC
Pfam:Med17 123 452 8.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034413
AA Change: M166L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034413
Gene: ENSMUSG00000031937
AA Change: M166L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IG 39 138 2e-3 SMART
transmembrane domain 147 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213788
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,350,012 K102E possibly damaging Het
Bsn G A 9: 108,111,030 Q2508* probably null Het
Cc2d2a A G 5: 43,703,888 T549A probably benign Het
Lyst A T 13: 13,696,663 S2662C probably damaging Het
Nek9 A G 12: 85,329,887 V240A possibly damaging Het
Nol4l T C 2: 153,418,039 D165G probably damaging Het
Olfr1098 A T 2: 86,923,107 Y142N probably benign Het
Olfr126 A T 17: 37,850,618 M9L probably benign Het
Olfr1335 A G 4: 118,809,822 V14A probably benign Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Plin5 T C 17: 56,115,588 E116G probably damaging Het
Slc35d2 C T 13: 64,129,305 M1I probably null Het
Srgap1 A T 10: 121,829,289 S493T probably benign Het
Syt9 T A 7: 107,436,699 Y308N probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r74 C T 7: 85,961,314 D57N probably benign Het
Zbtb12 T C 17: 34,895,698 L153P possibly damaging Het
Other mutations in Vstm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Vstm5 APN 9 15257379 missense probably damaging 1.00
IGL01781:Vstm5 APN 9 15257672 missense probably damaging 1.00
IGL02940:Vstm5 APN 9 15257666 missense probably damaging 1.00
R1155:Vstm5 UTSW 9 15257553 missense probably damaging 1.00
R1721:Vstm5 UTSW 9 15257367 missense probably benign 0.13
R3160:Vstm5 UTSW 9 15257298 missense probably benign 0.02
R3161:Vstm5 UTSW 9 15257298 missense probably benign 0.02
R3162:Vstm5 UTSW 9 15257298 missense probably benign 0.02
R4612:Vstm5 UTSW 9 15257493 missense probably benign 0.22
R4692:Vstm5 UTSW 9 15257422 missense probably damaging 0.99
R4950:Vstm5 UTSW 9 15257794 splice site probably null
R5088:Vstm5 UTSW 9 15257305 missense possibly damaging 0.87
R6351:Vstm5 UTSW 9 15257533 missense probably damaging 1.00
R7063:Vstm5 UTSW 9 15239253 start gained probably benign
R7720:Vstm5 UTSW 9 15239356 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTCACTGTCACAGAGCATCC -3'
(R):5'- AAGAGGTTGAAAATCTGTCACCC -3'

Sequencing Primer
(F):5'- TGTGTCTGGTAAGAGAGCCCC -3'
(R):5'- GTTGAAAATCTGTCACCCAGTGG -3'
Posted On2014-10-30