Mutagenetix > Incidental Mutations

Incidental Mutation 'R2368:Srgap1'

246404

Institutional Source

Beutler Lab

Gene Symbol

Srgap1

Ensembl Gene

ENSMUSG00000020121

Gene Name

SLIT-ROBO Rho GTPase activating protein 1

Synonyms

Arhgap13, 4930572H05Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R2368 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121780991-122047315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121829289 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 493 (S493T)

Ref Sequence

ENSEMBL: ENSMUSP00000080389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]

Predicted Effect

probably benign
Transcript: ENSMUST00000020322

SMART Domains

Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	494	668	1.27e-64	SMART
SH3	723	778	1.57e-14	SMART
low complexity region	826	840	N/A	INTRINSIC
low complexity region	1004	1014	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081688
AA Change: S493T

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: S493T

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	517	691	1.27e-64	SMART
SH3	746	801	1.57e-14	SMART
low complexity region	849	863	N/A	INTRINSIC
low complexity region	1027	1037	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218664

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid2	A	G	15: 96,350,012	K102E	possibly damaging	Het
Bsn	G	A	9: 108,111,030	Q2508*	probably null	Het
Cc2d2a	A	G	5: 43,703,888	T549A	probably benign	Het
Lyst	A	T	13: 13,696,663	S2662C	probably damaging	Het
Nek9	A	G	12: 85,329,887	V240A	possibly damaging	Het
Nol4l	T	C	2: 153,418,039	D165G	probably damaging	Het
Olfr1098	A	T	2: 86,923,107	Y142N	probably benign	Het
Olfr126	A	T	17: 37,850,618	M9L	probably benign	Het
Olfr1335	A	G	4: 118,809,822	V14A	probably benign	Het
Olfr494	A	G	7: 108,368,369	Y293C	probably damaging	Het
Plin5	T	C	17: 56,115,588	E116G	probably damaging	Het
Slc35d2	C	T	13: 64,129,305	M1I	probably null	Het
Syt9	T	A	7: 107,436,699	Y308N	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r74	C	T	7: 85,961,314	D57N	probably benign	Het
Vstm5	A	T	9: 15,257,731	M166L	probably benign	Het
Zbtb12	T	C	17: 34,895,698	L153P	possibly damaging	Het

Other mutations in Srgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01964:Srgap1	APN	10	121804966	missense	possibly damaging	0.81
IGL02106:Srgap1	APN	10	121785693	missense	possibly damaging	0.95
IGL02927:Srgap1	APN	10	121855462	missense	probably damaging	0.99
IGL03088:Srgap1	APN	10	121825693	missense	possibly damaging	0.94
IGL03208:Srgap1	APN	10	121792266	missense	possibly damaging	0.89
IGL03251:Srgap1	APN	10	121804921	splice site	probably null
PIT1430001:Srgap1	UTSW	10	121896753	splice site	probably benign
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0356:Srgap1	UTSW	10	121855536	splice site	probably null
R0361:Srgap1	UTSW	10	122047192	start codon destroyed	probably null	0.89
R0365:Srgap1	UTSW	10	121785705	missense	possibly damaging	0.80
R0675:Srgap1	UTSW	10	121792235	missense	probably damaging	1.00
R0801:Srgap1	UTSW	10	121807875	missense	probably damaging	0.96
R0815:Srgap1	UTSW	10	121785474	missense	probably damaging	0.99
R1034:Srgap1	UTSW	10	121785445	missense	possibly damaging	0.69
R1160:Srgap1	UTSW	10	121855477	missense	probably benign	0.01
R1454:Srgap1	UTSW	10	121896738	missense	probably damaging	0.99
R1624:Srgap1	UTSW	10	121855373	missense	probably benign	0.03
R1628:Srgap1	UTSW	10	121870339	missense	probably benign	0.15
R1816:Srgap1	UTSW	10	121925971	nonsense	probably null
R1933:Srgap1	UTSW	10	121925903	missense	possibly damaging	0.89
R2034:Srgap1	UTSW	10	121792746	missense	probably damaging	0.98
R2211:Srgap1	UTSW	10	121853740	missense	possibly damaging	0.55
R2295:Srgap1	UTSW	10	121794760	missense	probably benign	0.03
R3796:Srgap1	UTSW	10	122047132	missense	probably benign	0.06
R4083:Srgap1	UTSW	10	121785690	missense	probably damaging	1.00
R4172:Srgap1	UTSW	10	121855363	missense	probably benign	0.00
R4322:Srgap1	UTSW	10	121869806	missense	probably damaging	1.00
R4401:Srgap1	UTSW	10	121804921	splice site	probably null
R4513:Srgap1	UTSW	10	121870326	critical splice donor site	probably null
R4698:Srgap1	UTSW	10	121792487	missense	probably benign	0.22
R4776:Srgap1	UTSW	10	121792351	missense	probably benign	0.03
R4951:Srgap1	UTSW	10	121785552	missense	probably benign	0.20
R5116:Srgap1	UTSW	10	121792379	missense	possibly damaging	0.77
R5232:Srgap1	UTSW	10	121840911	missense	probably benign	0.00
R5237:Srgap1	UTSW	10	121807883	missense	probably damaging	1.00
R5335:Srgap1	UTSW	10	121785377	utr 3 prime	probably benign
R5402:Srgap1	UTSW	10	121785760	missense	probably benign	0.06
R5432:Srgap1	UTSW	10	121869823	missense	probably damaging	1.00
R5456:Srgap1	UTSW	10	121869811	missense	probably benign	0.45
R5669:Srgap1	UTSW	10	121804850	missense	probably benign	0.00
R5682:Srgap1	UTSW	10	121805014	missense	probably damaging	1.00
R5687:Srgap1	UTSW	10	121825636	missense	probably damaging	1.00
R5773:Srgap1	UTSW	10	121896709	missense	probably benign	0.02
R5832:Srgap1	UTSW	10	121840914	missense	probably damaging	1.00
R6028:Srgap1	UTSW	10	121828730	missense	probably null
R6240:Srgap1	UTSW	10	122047156	missense	probably benign	0.06
R6336:Srgap1	UTSW	10	121925941	missense	probably benign	0.01
R6435:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R6597:Srgap1	UTSW	10	121792371	missense	probably benign	0.11
R6798:Srgap1	UTSW	10	121925904	missense	probably damaging	1.00
R6807:Srgap1	UTSW	10	121828726	splice site	probably null
R6897:Srgap1	UTSW	10	121785618	missense	probably damaging	0.96
R7057:Srgap1	UTSW	10	121804953	missense	probably benign	0.20
R7196:Srgap1	UTSW	10	121840848	missense	probably benign	0.00
R7247:Srgap1	UTSW	10	121869790	missense	probably damaging	0.98
R7404:Srgap1	UTSW	10	121785745	missense	probably benign	0.18
R7467:Srgap1	UTSW	10	121855439	nonsense	probably null
R7792:Srgap1	UTSW	10	121925967	missense	probably damaging	0.98
R7846:Srgap1	UTSW	10	121785492	missense	probably damaging	0.97
R7896:Srgap1	UTSW	10	121853553	critical splice donor site	probably benign
R7912:Srgap1	UTSW	10	121853553	critical splice donor site	probably benign
R8127:Srgap1	UTSW	10	121855366	missense	probably null	0.04
R8233:Srgap1	UTSW	10	121825436	missense	probably damaging	1.00
R8248:Srgap1	UTSW	10	121804817	missense	probably damaging	0.99
R8362:Srgap1	UTSW	10	121855478	missense	possibly damaging	0.46
X0063:Srgap1	UTSW	10	121785412	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCTGGGGAATTGAAGAGCCC -3'
(R):5'- ACAACTCCTATGCTCTTGATGTAC -3'

Sequencing Primer
(F):5'- TTGAAGAGCCCCAGGACATAATGAC -3'
(R):5'- TGCTCTTGATGTACAAATAAAAGAGG -3'

Posted On

2014-10-30