Incidental Mutation 'R2368:Slc35d2'
ID246408
Institutional Source Beutler Lab
Gene Symbol Slc35d2
Ensembl Gene ENSMUSG00000033114
Gene Namesolute carrier family 35, member D2
SynonymsSQV7L, UGTrel8, 5730408I21Rik, hfrc
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R2368 (G1)
Quality Score82
Status Not validated
Chromosome13
Chromosomal Location64096308-64129368 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to T at 64129305 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000152555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059817] [ENSMUST00000099441] [ENSMUST00000220792] [ENSMUST00000222168] [ENSMUST00000222794] [ENSMUST00000222866] [ENSMUST00000223461]
Predicted Effect probably benign
Transcript: ENSMUST00000059817
SMART Domains Protein: ENSMUSP00000050854
Gene: ENSMUSG00000044934

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 105 113 N/A INTRINSIC
ZnF_C2H2 157 179 3.44e-4 SMART
ZnF_C2H2 185 209 2.4e-3 SMART
coiled coil region 299 332 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099441
AA Change: M1I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097040
Gene: ENSMUSG00000033114
AA Change: M1I

DomainStartEndE-ValueType
Pfam:TPT 12 301 4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000220792
AA Change: M1I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably null
Transcript: ENSMUST00000222168
AA Change: M1I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222692
Predicted Effect probably null
Transcript: ENSMUST00000222794
AA Change: M1I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably null
Transcript: ENSMUST00000222866
AA Change: M1I
Predicted Effect probably null
Transcript: ENSMUST00000223461
AA Change: M1I
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleotide sugars, which are synthesized in the cytosol or the nucleus, are high-energy donor substrates for glycosyltransferases located in the lumen of the endoplasmic reticulum and Golgi apparatus. Translocation of nucleotide sugars from the cytosol into the lumen compartment is mediated by specific nucleotide sugar transporters, such as SLC35D2 (Suda et al., 2004 [PubMed 15082721]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,350,012 K102E possibly damaging Het
Bsn G A 9: 108,111,030 Q2508* probably null Het
Cc2d2a A G 5: 43,703,888 T549A probably benign Het
Lyst A T 13: 13,696,663 S2662C probably damaging Het
Nek9 A G 12: 85,329,887 V240A possibly damaging Het
Nol4l T C 2: 153,418,039 D165G probably damaging Het
Olfr1098 A T 2: 86,923,107 Y142N probably benign Het
Olfr126 A T 17: 37,850,618 M9L probably benign Het
Olfr1335 A G 4: 118,809,822 V14A probably benign Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Plin5 T C 17: 56,115,588 E116G probably damaging Het
Srgap1 A T 10: 121,829,289 S493T probably benign Het
Syt9 T A 7: 107,436,699 Y308N probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r74 C T 7: 85,961,314 D57N probably benign Het
Vstm5 A T 9: 15,257,731 M166L probably benign Het
Zbtb12 T C 17: 34,895,698 L153P possibly damaging Het
Other mutations in Slc35d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Slc35d2 APN 13 64098348 missense probably damaging 1.00
IGL02315:Slc35d2 APN 13 64107035 missense possibly damaging 0.87
R1612:Slc35d2 UTSW 13 64111510 splice site probably benign
R4713:Slc35d2 UTSW 13 64099283 missense possibly damaging 0.94
R5338:Slc35d2 UTSW 13 64097682 missense possibly damaging 0.68
R5823:Slc35d2 UTSW 13 64120605 missense probably damaging 0.98
R5840:Slc35d2 UTSW 13 64118413 splice site probably null
R8020:Slc35d2 UTSW 13 64107043 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCACACTCGGCTTTCCAAG -3'
(R):5'- GAAACGAACCTCAGCCTTTCTG -3'

Sequencing Primer
(F):5'- TTTCCAAGCCCCGGCCAC -3'
(R):5'- CCGGCTAAGGCAGTTTTTCG -3'
Posted On2014-10-30