Incidental Mutation 'R2368:Olfr126'
ID246415
Institutional Source Beutler Lab
Gene Symbol Olfr126
Ensembl Gene ENSMUSG00000109212
Gene Nameolfactory receptor 126
SynonymsGA_x6K02T2PSCP-2307164-2308123, MOR218-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R2368 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37847483-37852057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37850618 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 9 (M9L)
Ref Sequence ENSEMBL: ENSMUSP00000076203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076936] [ENSMUST00000174139] [ENSMUST00000213844] [ENSMUST00000217487]
Predicted Effect probably benign
Transcript: ENSMUST00000076936
AA Change: M9L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076203
Gene: ENSMUSG00000092413
AA Change: M9L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 24 252 2.6e-7 PFAM
Pfam:7tm_4 31 308 3.2e-45 PFAM
Pfam:7tm_1 41 290 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174139
AA Change: M9L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134080
Gene: ENSMUSG00000109212
AA Change: M9L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-46 PFAM
Pfam:7TM_GPCR_Srx 32 307 3.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.2e-6 PFAM
Pfam:7tm_1 41 290 2.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201362
AA Change: M9L
Predicted Effect probably benign
Transcript: ENSMUST00000213844
AA Change: M9L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217487
AA Change: M9L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,350,012 K102E possibly damaging Het
Bsn G A 9: 108,111,030 Q2508* probably null Het
Cc2d2a A G 5: 43,703,888 T549A probably benign Het
Lyst A T 13: 13,696,663 S2662C probably damaging Het
Nek9 A G 12: 85,329,887 V240A possibly damaging Het
Nol4l T C 2: 153,418,039 D165G probably damaging Het
Olfr1098 A T 2: 86,923,107 Y142N probably benign Het
Olfr1335 A G 4: 118,809,822 V14A probably benign Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Plin5 T C 17: 56,115,588 E116G probably damaging Het
Slc35d2 C T 13: 64,129,305 M1I probably null Het
Srgap1 A T 10: 121,829,289 S493T probably benign Het
Syt9 T A 7: 107,436,699 Y308N probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r74 C T 7: 85,961,314 D57N probably benign Het
Vstm5 A T 9: 15,257,731 M166L probably benign Het
Zbtb12 T C 17: 34,895,698 L153P possibly damaging Het
Other mutations in Olfr126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Olfr126 APN 17 37850623 missense probably benign 0.01
IGL01656:Olfr126 APN 17 37851138 missense possibly damaging 0.60
IGL01674:Olfr126 APN 17 37609962 missense probably damaging 0.99
IGL01903:Olfr126 APN 17 37609867 missense possibly damaging 0.64
IGL02262:Olfr126 APN 17 37851263 missense probably damaging 1.00
IGL02445:Olfr126 APN 17 37851117 missense probably damaging 0.97
R0559:Olfr126 UTSW 17 37850855 nonsense probably null
R1164:Olfr126 UTSW 17 37850684 missense probably damaging 0.99
R1828:Olfr126 UTSW 17 37851075 missense probably benign 0.11
R1840:Olfr126 UTSW 17 37850748 missense probably damaging 1.00
R1882:Olfr126 UTSW 17 37850948 missense probably damaging 1.00
R2377:Olfr126 UTSW 17 37850607 missense probably damaging 1.00
R3832:Olfr126 UTSW 17 37851180 missense probably benign 0.00
R6589:Olfr126 UTSW 17 37850836 nonsense probably null
R7794:Olfr126 UTSW 17 37850787 missense probably benign 0.10
R7853:Olfr126 UTSW 17 37850823 missense probably damaging 1.00
R8009:Olfr126 UTSW 17 37850802 missense probably damaging 1.00
R8501:Olfr126 UTSW 17 37850865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTGATGAACTGCAATTCC -3'
(R):5'- CAGAGTGGAAAGTTGCTTCAG -3'

Sequencing Primer
(F):5'- GTGTGATGAACTGCAATTCCTTAAAC -3'
(R):5'- TCAGAAAATAATACATTGGAGACTGG -3'
Posted On2014-10-30