Incidental Mutation 'R2368:Plin5'
ID246417
Institutional Source Beutler Lab
Gene Symbol Plin5
Ensembl Gene ENSMUSG00000011305
Gene Nameperilipin 5
SynonymsMLDP, Lsdp5, 2310076L09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2368 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56111601-56117596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56115588 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 116 (E116G)
Ref Sequence ENSEMBL: ENSMUSP00000108695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019808] [ENSMUST00000041357] [ENSMUST00000113072]
Predicted Effect probably damaging
Transcript: ENSMUST00000019808
AA Change: E116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019808
Gene: ENSMUSG00000011305
AA Change: E116G

DomainStartEndE-ValueType
Pfam:Perilipin 31 383 1.2e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041357
SMART Domains Protein: ENSMUSP00000038048
Gene: ENSMUSG00000037095

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRR 84 107 1.86e0 SMART
LRR_TYP 108 131 3.63e-3 SMART
LRR 133 155 5.89e1 SMART
LRR_TYP 156 179 1.45e-2 SMART
LRR_TYP 180 203 8.47e-4 SMART
LRR 205 227 2.08e1 SMART
LRR 229 251 1.91e1 SMART
LRR 252 275 5.34e-1 SMART
LRRCT 292 342 9.69e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113072
AA Change: E116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108695
Gene: ENSMUSG00000011305
AA Change: E116G

DomainStartEndE-ValueType
Pfam:Perilipin 27 384 2.3e-128 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN5, coat intracellular lipid storage droplets and protect them from lipolytic degradation (Dalen et al., 2007 [PubMed 17234449]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit excessive fatty acid oxidation, abnormal lipid levels in organs depending on fed or fasted state, increased oxygen consumption and activity in the dark phase, and decreased cardiac muscle contractility in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,350,012 K102E possibly damaging Het
Bsn G A 9: 108,111,030 Q2508* probably null Het
Cc2d2a A G 5: 43,703,888 T549A probably benign Het
Lyst A T 13: 13,696,663 S2662C probably damaging Het
Nek9 A G 12: 85,329,887 V240A possibly damaging Het
Nol4l T C 2: 153,418,039 D165G probably damaging Het
Olfr1098 A T 2: 86,923,107 Y142N probably benign Het
Olfr126 A T 17: 37,850,618 M9L probably benign Het
Olfr1335 A G 4: 118,809,822 V14A probably benign Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Slc35d2 C T 13: 64,129,305 M1I probably null Het
Srgap1 A T 10: 121,829,289 S493T probably benign Het
Syt9 T A 7: 107,436,699 Y308N probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r74 C T 7: 85,961,314 D57N probably benign Het
Vstm5 A T 9: 15,257,731 M166L probably benign Het
Zbtb12 T C 17: 34,895,698 L153P possibly damaging Het
Other mutations in Plin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0304:Plin5 UTSW 17 56115597 missense probably damaging 1.00
R0981:Plin5 UTSW 17 56114020 missense probably damaging 1.00
R1966:Plin5 UTSW 17 56112186 missense probably damaging 1.00
R2153:Plin5 UTSW 17 56116836 missense probably benign 0.02
R4809:Plin5 UTSW 17 56116855 missense probably benign 0.00
R5173:Plin5 UTSW 17 56115548 splice site probably null
R5315:Plin5 UTSW 17 56114066 missense probably benign 0.15
R5836:Plin5 UTSW 17 56115549 critical splice donor site probably null
R7129:Plin5 UTSW 17 56115174 missense probably null
R7510:Plin5 UTSW 17 56113975 missense probably damaging 0.97
R8305:Plin5 UTSW 17 56115221 missense probably benign 0.00
X0028:Plin5 UTSW 17 56116324 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCCTAACAGTCCTTGAGAAG -3'
(R):5'- TGAACTGAGAGACCCAGCAG -3'

Sequencing Primer
(F):5'- GTTTCCCTCCATTAAATAGACAGC -3'
(R):5'- CTGAGAGACCCAGCAGAGGATG -3'
Posted On2014-10-30