Incidental Mutation 'R2369:Paqr6'
ID246422
Institutional Source Beutler Lab
Gene Symbol Paqr6
Ensembl Gene ENSMUSG00000041423
Gene Nameprogestin and adipoQ receptor family member VI
Synonyms
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2369 (G1)
Quality Score207
Status Not validated
Chromosome3
Chromosomal Location88364584-88368541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88365953 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 84 (L84P)
Ref Sequence ENSEMBL: ENSMUSP00000114166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451] [ENSMUST00000075523] [ENSMUST00000107542] [ENSMUST00000107543] [ENSMUST00000147948] [ENSMUST00000147991]
Predicted Effect probably benign
Transcript: ENSMUST00000001451
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075523
SMART Domains Protein: ENSMUSP00000074965
Gene: ENSMUSG00000074489

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107542
SMART Domains Protein: ENSMUSP00000103166
Gene: ENSMUSG00000074489

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107543
SMART Domains Protein: ENSMUSP00000103167
Gene: ENSMUSG00000074489

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147818
Predicted Effect probably benign
Transcript: ENSMUST00000147948
SMART Domains Protein: ENSMUSP00000119656
Gene: ENSMUSG00000041423

DomainStartEndE-ValueType
Pfam:HlyIII 59 161 6.8e-18 PFAM
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147991
AA Change: L84P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114166
Gene: ENSMUSG00000041423
AA Change: L84P

DomainStartEndE-ValueType
Pfam:HlyIII 43 271 5.5e-51 PFAM
transmembrane domain 292 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194359
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in Paqr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Paqr6 APN 3 88366184 missense probably damaging 1.00
IGL02622:Paqr6 APN 3 88365778 missense probably damaging 1.00
PIT4431001:Paqr6 UTSW 3 88365777 missense possibly damaging 0.87
R0883:Paqr6 UTSW 3 88365991 missense probably damaging 1.00
R4705:Paqr6 UTSW 3 88365929 missense probably benign 0.03
R5103:Paqr6 UTSW 3 88367717 nonsense probably null
R5922:Paqr6 UTSW 3 88366237 missense probably benign 0.00
R6292:Paqr6 UTSW 3 88367898 missense probably damaging 1.00
R6364:Paqr6 UTSW 3 88365958 missense probably damaging 0.98
R7023:Paqr6 UTSW 3 88366046 missense probably damaging 1.00
Z1177:Paqr6 UTSW 3 88365709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGTCAACATCTGGACTCAC -3'
(R):5'- CTTTCAGACACTGGGGATGC -3'

Sequencing Primer
(F):5'- AACATCTGGACTCACTTCCTG -3'
(R):5'- GAACCCACCGCGAGTAG -3'
Posted On2014-10-30