Incidental Mutation 'R2369:Ahcyl1'
ID246423
Institutional Source Beutler Lab
Gene Symbol Ahcyl1
Ensembl Gene ENSMUSG00000027893
Gene NameS-adenosylhomocysteine hydrolase-like 1
SynonymsAhcy-rs3, 1110034F20Rik, DCAL, IRBIT
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2369 (G1)
Quality Score185
Status Not validated
Chromosome3
Chromosomal Location107663118-107696560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107670240 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 288 (D288G)
Ref Sequence ENSEMBL: ENSMUSP00000029490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029490] [ENSMUST00000153623]
Predicted Effect probably damaging
Transcript: ENSMUST00000029490
AA Change: D288G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029490
Gene: ENSMUSG00000027893
AA Change: D288G

DomainStartEndE-ValueType
Blast:AdoHcyase 10 40 1e-8 BLAST
low complexity region 61 87 N/A INTRINSIC
AdoHcyase 104 529 3.29e-266 SMART
AdoHcyase_NAD 289 450 6.69e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137583
Predicted Effect probably benign
Transcript: ENSMUST00000138091
SMART Domains Protein: ENSMUSP00000117909
Gene: ENSMUSG00000027893

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:AdoHcyase 43 168 2e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153530
Predicted Effect probably benign
Transcript: ENSMUST00000153623
SMART Domains Protein: ENSMUSP00000121510
Gene: ENSMUSG00000027893

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:AdoHcyase 56 210 4.7e-71 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with inositol 1,4,5-trisphosphate receptor, type 1 and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display abnormal exocrine pancreas physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in Ahcyl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Ahcyl1 APN 3 107667694 missense probably damaging 1.00
IGL02957:Ahcyl1 APN 3 107667642 missense probably damaging 1.00
R0226:Ahcyl1 UTSW 3 107670270 nonsense probably null
R0670:Ahcyl1 UTSW 3 107671165 missense probably damaging 1.00
R1537:Ahcyl1 UTSW 3 107696189 missense probably benign
R1779:Ahcyl1 UTSW 3 107674103 missense probably benign
R2355:Ahcyl1 UTSW 3 107670217 missense probably damaging 1.00
R4689:Ahcyl1 UTSW 3 107665518 nonsense probably null
R4712:Ahcyl1 UTSW 3 107667231 unclassified probably benign
R4721:Ahcyl1 UTSW 3 107669917 missense possibly damaging 0.89
R4996:Ahcyl1 UTSW 3 107668287 missense probably damaging 1.00
R5289:Ahcyl1 UTSW 3 107669890 critical splice donor site probably null
R6692:Ahcyl1 UTSW 3 107675085 missense probably damaging 1.00
R6881:Ahcyl1 UTSW 3 107668109 missense probably damaging 1.00
R7502:Ahcyl1 UTSW 3 107671197 nonsense probably null
R7853:Ahcyl1 UTSW 3 107668288 missense probably benign 0.18
R7895:Ahcyl1 UTSW 3 107669151 missense probably damaging 0.99
R8055:Ahcyl1 UTSW 3 107668731 missense probably benign 0.00
Z1177:Ahcyl1 UTSW 3 107673435 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCACTGTGAAGTGGGCTCC -3'
(R):5'- GACTAGTCACGTTTCCAAAGAACTTC -3'

Sequencing Primer
(F):5'- CTGTGAAGTGGGCTCCTTTAATAAC -3'
(R):5'- ACGTTTCCAAAGAACTTCTGGGC -3'
Posted On2014-10-30