Incidental Mutation 'R2369:Gbp5'
ID246424
Institutional Source Beutler Lab
Gene Symbol Gbp5
Ensembl Gene ENSMUSG00000105504
Gene Nameguanylate binding protein 5
Synonyms5330409J06Rik, Gbp5a
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2369 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location142493978-142522344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142500719 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 55 (M55L)
Ref Sequence ENSEMBL: ENSMUSP00000142938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090127] [ENSMUST00000196255] [ENSMUST00000197459]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090127
AA Change: M55L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087587
Gene: ENSMUSG00000105504
AA Change: M55L

DomainStartEndE-ValueType
Pfam:GBP 18 281 4e-113 PFAM
Pfam:GBP_C 283 575 6e-109 PFAM
low complexity region 579 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196255
AA Change: M55L

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143336
Gene: ENSMUSG00000105504
AA Change: M55L

DomainStartEndE-ValueType
Pfam:GBP 18 281 2.8e-113 PFAM
Pfam:GBP_C 283 556 5.5e-106 PFAM
internal_repeat_1 579 640 3.01e-21 PROSPERO
internal_repeat_1 647 708 3.01e-21 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000197459
AA Change: M55L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142938
Gene: ENSMUSG00000105504
AA Change: M55L

DomainStartEndE-ValueType
Pfam:GBP 18 65 4.7e-16 PFAM
Pfam:GBP 63 169 4.8e-33 PFAM
Pfam:GBP_C 171 444 9.3e-104 PFAM
internal_repeat_1 467 528 5.89e-22 PROSPERO
internal_repeat_1 535 596 5.89e-22 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199578
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The encoded protein acts as an activator of NLRP3 inflammasome assembly and has a role in innate immunity and inflammation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Listeria infection and NLRP3 inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in Gbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Gbp5 APN 3 142500594 missense probably damaging 1.00
IGL01625:Gbp5 APN 3 142503028 missense probably damaging 0.98
IGL02294:Gbp5 APN 3 142503827 missense probably damaging 1.00
PIT4362001:Gbp5 UTSW 3 142500710 missense probably damaging 1.00
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0166:Gbp5 UTSW 3 142506919 critical splice donor site probably null
R0357:Gbp5 UTSW 3 142505411 missense probably benign 0.05
R0414:Gbp5 UTSW 3 142507913 critical splice acceptor site probably null
R0457:Gbp5 UTSW 3 142507757 missense probably damaging 1.00
R0959:Gbp5 UTSW 3 142503124 missense possibly damaging 0.47
R1520:Gbp5 UTSW 3 142508014 missense probably damaging 0.97
R2143:Gbp5 UTSW 3 142503832 missense probably damaging 1.00
R3155:Gbp5 UTSW 3 142503127 critical splice donor site probably null
R4602:Gbp5 UTSW 3 142503785 missense probably benign 0.06
R4770:Gbp5 UTSW 3 142508076 missense possibly damaging 0.75
R5096:Gbp5 UTSW 3 142501361 missense probably damaging 1.00
R5605:Gbp5 UTSW 3 142501276 missense probably damaging 1.00
R7066:Gbp5 UTSW 3 142507729 missense probably benign 0.00
R7234:Gbp5 UTSW 3 142521137 missense probably benign 0.00
R7237:Gbp5 UTSW 3 142507700 missense probably benign 0.41
R7258:Gbp5 UTSW 3 142506781 missense probably damaging 1.00
R7475:Gbp5 UTSW 3 142501361 missense probably damaging 1.00
R7521:Gbp5 UTSW 3 142500621 missense probably benign 0.06
R7627:Gbp5 UTSW 3 142500558 start codon destroyed probably null 1.00
R7788:Gbp5 UTSW 3 142503080 missense probably damaging 1.00
R8077:Gbp5 UTSW 3 142507739 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTCCCCTGCAGAGACATG -3'
(R):5'- ACACATGCTAAGTCACAGAGAG -3'

Sequencing Primer
(F):5'- TGGCCCCAGAGATTCACATG -3'
(R):5'- GAGAGAGAGAGCTTCCCTTTATCTC -3'
Posted On2014-10-30