Incidental Mutation 'R2369:Ing3'
ID246427
Institutional Source Beutler Lab
Gene Symbol Ing3
Ensembl Gene ENSMUSG00000029670
Gene Nameinhibitor of growth family, member 3
Synonyms1300013A07Rik, P47ING3
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2369 (G1)
Quality Score135
Status Not validated
Chromosome6
Chromosomal Location21949571-21976038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21950091 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 28 (M28V)
Ref Sequence ENSEMBL: ENSMUSP00000031680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031680] [ENSMUST00000115389] [ENSMUST00000136200] [ENSMUST00000149728] [ENSMUST00000151473] [ENSMUST00000152877]
Predicted Effect probably damaging
Transcript: ENSMUST00000031680
AA Change: M28V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031680
Gene: ENSMUSG00000029670
AA Change: M28V

DomainStartEndE-ValueType
Pfam:ING 3 104 2.7e-31 PFAM
low complexity region 214 239 N/A INTRINSIC
low complexity region 308 345 N/A INTRINSIC
PHD 365 410 4e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115389
AA Change: M28V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111047
Gene: ENSMUSG00000029670
AA Change: M28V

DomainStartEndE-ValueType
Pfam:ING 2 104 1.5e-33 PFAM
low complexity region 203 228 N/A INTRINSIC
low complexity region 297 334 N/A INTRINSIC
PHD 354 399 6.39e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136200
AA Change: M28V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138656
Gene: ENSMUSG00000029670
AA Change: M28V

DomainStartEndE-ValueType
Pfam:ING 2 41 1.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144534
Predicted Effect possibly damaging
Transcript: ENSMUST00000149728
AA Change: M13V

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145391
Gene: ENSMUSG00000029670
AA Change: M13V

DomainStartEndE-ValueType
Pfam:ING 1 89 6.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151473
SMART Domains Protein: ENSMUSP00000120651
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 2 80 1.9e-19 PFAM
low complexity region 190 215 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152877
AA Change: M28V

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138244
Gene: ENSMUSG00000029670
AA Change: M28V

DomainStartEndE-ValueType
Pfam:ING 2 89 1.5e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in Ing3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Ing3 APN 6 21968880 splice site probably benign
IGL02330:Ing3 APN 6 21952121 missense probably benign 0.00
IGL02668:Ing3 APN 6 21950059 missense probably damaging 0.98
IGL02897:Ing3 APN 6 21969326 missense probably benign 0.14
IGL03065:Ing3 APN 6 21971222 missense probably benign
R0076:Ing3 UTSW 6 21952171 missense probably benign
R0513:Ing3 UTSW 6 21970035 missense probably damaging 0.98
R0711:Ing3 UTSW 6 21971237 nonsense probably null
R4660:Ing3 UTSW 6 21973711 utr 3 prime probably benign
R4672:Ing3 UTSW 6 21965730 splice site probably null
R5557:Ing3 UTSW 6 21968909 missense possibly damaging 0.95
R5682:Ing3 UTSW 6 21968950 missense probably damaging 0.98
R5773:Ing3 UTSW 6 21971835 missense probably damaging 1.00
R5774:Ing3 UTSW 6 21967689 missense probably benign
R5914:Ing3 UTSW 6 21968905 missense probably benign 0.18
R5976:Ing3 UTSW 6 21971174 missense probably benign 0.09
R6265:Ing3 UTSW 6 21953814 missense probably damaging 0.99
R7239:Ing3 UTSW 6 21952194 missense probably damaging 0.99
R7526:Ing3 UTSW 6 21953799 missense probably damaging 1.00
R8112:Ing3 UTSW 6 21952182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCACGGTAACTGGCAGC -3'
(R):5'- AATCACGCGAGTTTCCACTG -3'

Sequencing Primer
(F):5'- TAACTGGCAGCCTCGTTG -3'
(R):5'- AGTGTCGTCATCTCCATGCAG -3'
Posted On2014-10-30