Incidental Mutation 'R2369:Grik5'
ID246430
Institutional Source Beutler Lab
Gene Symbol Grik5
Ensembl Gene ENSMUSG00000003378
Gene Nameglutamate receptor, ionotropic, kainate 5 (gamma 2)
SynonymsGluRgamma2, KA2
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R2369 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25009849-25072346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25058537 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 373 (Y373C)
Ref Sequence ENSEMBL: ENSMUSP00000003468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000205328] [ENSMUST00000206134]
Predicted Effect probably damaging
Transcript: ENSMUST00000003468
AA Change: Y373C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: Y373C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 40 381 3.4e-64 PFAM
PBPe 416 785 3.7e-122 SMART
Lig_chan-Glu_bd 426 490 1.65e-29 SMART
transmembrane domain 804 823 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 893 921 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206132
Predicted Effect probably benign
Transcript: ENSMUST00000206134
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in Grik5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Grik5 APN 7 25065393 missense probably damaging 1.00
IGL00974:Grik5 APN 7 25013885 missense probably damaging 1.00
IGL01941:Grik5 APN 7 25065182 missense probably damaging 1.00
IGL02642:Grik5 APN 7 25058983 missense possibly damaging 0.51
IGL03177:Grik5 APN 7 25015454 missense probably damaging 1.00
IGL03402:Grik5 APN 7 25015469 missense probably damaging 1.00
Griffin UTSW 7 25059077 missense possibly damaging 0.78
PIT4453001:Grik5 UTSW 7 25010694 missense probably damaging 0.99
R0077:Grik5 UTSW 7 25023380 missense probably damaging 1.00
R0412:Grik5 UTSW 7 25013674 missense possibly damaging 0.59
R0427:Grik5 UTSW 7 25058498 missense probably benign 0.34
R1191:Grik5 UTSW 7 25058325 nonsense probably null
R1830:Grik5 UTSW 7 25046301 missense possibly damaging 0.94
R2072:Grik5 UTSW 7 25015313 missense possibly damaging 0.92
R3410:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3411:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3615:Grik5 UTSW 7 25022571 missense probably benign 0.37
R3616:Grik5 UTSW 7 25022571 missense probably benign 0.37
R4600:Grik5 UTSW 7 25068064 missense probably damaging 0.99
R4658:Grik5 UTSW 7 25060727 splice site probably benign
R4735:Grik5 UTSW 7 25058288 missense probably damaging 1.00
R4810:Grik5 UTSW 7 25015497 missense probably damaging 0.98
R5113:Grik5 UTSW 7 25015527 missense probably damaging 1.00
R5120:Grik5 UTSW 7 25010640 missense probably damaging 1.00
R5132:Grik5 UTSW 7 25065204 missense probably benign 0.02
R5173:Grik5 UTSW 7 25062894 missense possibly damaging 0.76
R5186:Grik5 UTSW 7 25015819 missense probably damaging 1.00
R5239:Grik5 UTSW 7 25065470 missense probably damaging 1.00
R5935:Grik5 UTSW 7 25059077 missense possibly damaging 0.78
R6335:Grik5 UTSW 7 25013594 missense probably benign
R6609:Grik5 UTSW 7 25015526 nonsense probably null
R6760:Grik5 UTSW 7 25058939 critical splice donor site probably null
R6820:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6821:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6822:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6824:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R7173:Grik5 UTSW 7 25068162 missense probably damaging 1.00
R7230:Grik5 UTSW 7 25023070 missense probably damaging 1.00
R7555:Grik5 UTSW 7 25060597 missense probably benign
R7560:Grik5 UTSW 7 25058526 missense probably damaging 0.99
R7571:Grik5 UTSW 7 25013885 missense possibly damaging 0.87
R8228:Grik5 UTSW 7 25010508 missense probably damaging 1.00
R8228:Grik5 UTSW 7 25046310 missense possibly damaging 0.93
X0017:Grik5 UTSW 7 25060588 missense probably damaging 1.00
Z1176:Grik5 UTSW 7 25013804 missense probably damaging 0.98
Z1177:Grik5 UTSW 7 25015825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTTGATGTCCAGGGTG -3'
(R):5'- TGTCTGACCATGCCACTGTC -3'

Sequencing Primer
(F):5'- ATTCATGGCCAGGGTCCG -3'
(R):5'- ACCATGCCACTGTCCCTGTG -3'
Posted On2014-10-30