Incidental Mutation 'R2369:Lmtk3'
ID246431
Institutional Source Beutler Lab
Gene Symbol Lmtk3
Ensembl Gene ENSMUSG00000062044
Gene Namelemur tyrosine kinase 3
SynonymsAATYK3, Aatyk3
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R2369 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45783738-45804144 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 45795088 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000072580] [ENSMUST00000120005] [ENSMUST00000209617] [ENSMUST00000209701]
Predicted Effect unknown
Transcript: ENSMUST00000072580
AA Change: Q1039L
SMART Domains Protein: ENSMUSP00000072388
Gene: ENSMUSG00000062044
AA Change: Q1039L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118564
AA Change: Q1065L
SMART Domains Protein: ENSMUSP00000113323
Gene: ENSMUSG00000062044
AA Change: Q1065L

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Pkinase_Tyr 159 434 4.2e-64 PFAM
Pfam:Pkinase 159 436 1.3e-33 PFAM
low complexity region 441 470 N/A INTRINSIC
low complexity region 510 532 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 665 695 N/A INTRINSIC
low complexity region 761 817 N/A INTRINSIC
low complexity region 823 869 N/A INTRINSIC
low complexity region 1107 1131 N/A INTRINSIC
low complexity region 1142 1158 N/A INTRINSIC
low complexity region 1222 1249 N/A INTRINSIC
low complexity region 1251 1289 N/A INTRINSIC
low complexity region 1371 1388 N/A INTRINSIC
low complexity region 1410 1419 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120005
AA Change: Q1039L
SMART Domains Protein: ENSMUSP00000112592
Gene: ENSMUSG00000062044
AA Change: Q1039L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209351
Predicted Effect unknown
Transcript: ENSMUST00000209617
AA Change: Q1065L
Predicted Effect probably benign
Transcript: ENSMUST00000209701
Predicted Effect probably benign
Transcript: ENSMUST00000211127
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pronounced behavioral abnormalities, including locomotor hyperactivity, reduced anxiety, and decreased depression-like behavior, an increased striatal dopamine turnover rate, and enhanced behavioral response to methylphenidate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in Lmtk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lmtk3 APN 7 45790907 missense probably damaging 1.00
IGL01996:Lmtk3 APN 7 45793447 splice site probably null
IGL02146:Lmtk3 APN 7 45794947 unclassified probably benign
IGL02192:Lmtk3 APN 7 45794509 unclassified probably benign
IGL02598:Lmtk3 APN 7 45793140 missense probably damaging 1.00
BB006:Lmtk3 UTSW 7 45795148 missense unknown
BB016:Lmtk3 UTSW 7 45795148 missense unknown
R0469:Lmtk3 UTSW 7 45794112 missense possibly damaging 0.95
R0510:Lmtk3 UTSW 7 45794112 missense possibly damaging 0.95
R0603:Lmtk3 UTSW 7 45795556 unclassified probably benign
R0781:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1110:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1270:Lmtk3 UTSW 7 45793828 missense probably damaging 0.96
R1535:Lmtk3 UTSW 7 45794570 unclassified probably benign
R1666:Lmtk3 UTSW 7 45794164 missense probably benign 0.03
R1807:Lmtk3 UTSW 7 45793278 missense probably benign 0.02
R1883:Lmtk3 UTSW 7 45786849 missense probably damaging 1.00
R2060:Lmtk3 UTSW 7 45800911 critical splice acceptor site probably null
R2107:Lmtk3 UTSW 7 45793969 missense possibly damaging 0.56
R2214:Lmtk3 UTSW 7 45794853 unclassified probably benign
R4084:Lmtk3 UTSW 7 45793292 missense probably damaging 0.97
R4246:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4247:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4249:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4250:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4587:Lmtk3 UTSW 7 45794080 missense possibly damaging 0.92
R5026:Lmtk3 UTSW 7 45794412 unclassified probably benign
R5275:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5295:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5624:Lmtk3 UTSW 7 45786862 missense probably damaging 0.96
R5688:Lmtk3 UTSW 7 45791410 missense probably damaging 1.00
R6478:Lmtk3 UTSW 7 45798589 missense unknown
R6737:Lmtk3 UTSW 7 45793627 missense probably damaging 0.99
R6800:Lmtk3 UTSW 7 45793809 missense possibly damaging 0.91
R6856:Lmtk3 UTSW 7 45794297 unclassified probably benign
R7319:Lmtk3 UTSW 7 45794316 missense unknown
R7335:Lmtk3 UTSW 7 45795157 missense unknown
R7353:Lmtk3 UTSW 7 45788000 missense possibly damaging 0.46
R7621:Lmtk3 UTSW 7 45793417 missense probably damaging 1.00
R7699:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
R7700:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
R7836:Lmtk3 UTSW 7 45786903 missense possibly damaging 0.89
R7929:Lmtk3 UTSW 7 45795148 missense unknown
R7951:Lmtk3 UTSW 7 45785606 missense probably benign 0.01
R7976:Lmtk3 UTSW 7 45795466 missense unknown
R8128:Lmtk3 UTSW 7 45794174 missense
X0052:Lmtk3 UTSW 7 45793498 missense probably benign 0.03
X0067:Lmtk3 UTSW 7 45794680 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTCTGATGTCCCCAAAGAGC -3'
(R):5'- TCGAGTTGTCTACCCATCCG -3'

Sequencing Primer
(F):5'- TGTCCCCAAAGAGCGAGGAG -3'
(R):5'- TACCCATCCGGCCTTTGCG -3'
Posted On2014-10-30