Incidental Mutation 'R2369:9230112D13Rik'
ID246440
Institutional Source Beutler Lab
Gene Symbol 9230112D13Rik
Ensembl Gene ENSMUSG00000021797
Gene NameRIKEN cDNA 9230112D13 gene
Synonyms
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R2369 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34511621-34522801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34511956 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 126 (I126N)
Ref Sequence ENSEMBL: ENSMUSP00000022325 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000022325
AA Change: I126N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227512
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in 9230112D13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0532:9230112D13Rik UTSW 14 34512097 missense unknown
R0946:9230112D13Rik UTSW 14 34512142 missense unknown
R1475:9230112D13Rik UTSW 14 34512055 missense unknown
R2903:9230112D13Rik UTSW 14 34511941 missense unknown
R7627:9230112D13Rik UTSW 14 34512098 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCACAGTATGAATGTTGAATTGC -3'
(R):5'- TGGTACTAGAACGAAATCCGC -3'

Sequencing Primer
(F):5'- GCAGTACAGTTGACTGCATA -3'
(R):5'- GAAATCCGCAGCTGGCTTTTC -3'
Posted On2014-10-30