Incidental Mutation 'R2369:Dok6'
ID246449
Institutional Source Beutler Lab
Gene Symbol Dok6
Ensembl Gene ENSMUSG00000073514
Gene Namedocking protein 6
SynonymsDok-6
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2369 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location89301082-89769528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 89414864 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 274 (R274G)
Ref Sequence ENSEMBL: ENSMUSP00000095103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097495]
Predicted Effect probably null
Transcript: ENSMUST00000097495
AA Change: R274G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095103
Gene: ENSMUSG00000073514
AA Change: R274G

DomainStartEndE-ValueType
PH 8 114 8.99e-7 SMART
PTBI 130 232 4.39e-45 SMART
IRS 135 232 4.87e-41 SMART
low complexity region 316 328 N/A INTRINSIC
Meta Mutation Damage Score 0.1652 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DOK6 is a member of the DOK (see DOK1; MIM 602919) family of intracellular adaptors that play a role in the RET (MIM 164761) signaling cascade (Crowder et al., 2004 [PubMed 15286081]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in Dok6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1884:Dok6 UTSW 18 89474006 missense probably damaging 1.00
R1984:Dok6 UTSW 18 89560110 missense probably damaging 1.00
R2372:Dok6 UTSW 18 89414864 missense probably null 0.00
R4572:Dok6 UTSW 18 89473947 missense possibly damaging 0.95
R4587:Dok6 UTSW 18 89301196 missense probably benign 0.06
R4658:Dok6 UTSW 18 89473847 splice site probably benign
R5241:Dok6 UTSW 18 89598789 missense possibly damaging 0.77
R5995:Dok6 UTSW 18 89421018 missense possibly damaging 0.89
R7498:Dok6 UTSW 18 89769319 start gained probably benign
R7614:Dok6 UTSW 18 89473943 missense probably damaging 1.00
R7840:Dok6 UTSW 18 89560058 missense probably benign 0.00
R8041:Dok6 UTSW 18 89560089 missense possibly damaging 0.93
R8158:Dok6 UTSW 18 89473947 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTTGCACCCTGAGAAAGTTG -3'
(R):5'- TGACACAGCTATCCTTGAATAGG -3'

Sequencing Primer
(F):5'- TTGCACCCTGAGAAAGTTGATAAGTG -3'
(R):5'- ATCCTTGAATAGGGAATTATCTGGG -3'
Posted On2014-10-30