Incidental Mutation 'R2332:Slc4a11'
ID 246454
Institutional Source Beutler Lab
Gene Symbol Slc4a11
Ensembl Gene ENSMUSG00000074796
Gene Name solute carrier family 4, sodium bicarbonate transporter-like, member 11
Synonyms
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 130684113-130697519 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 130684459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 855 (V855D)
Ref Sequence ENSEMBL: ENSMUSP00000096963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099362] [ENSMUST00000103193]
AlphaFold A2AJN7
Predicted Effect probably benign
Transcript: ENSMUST00000099362
AA Change: V855D

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096963
Gene: ENSMUSG00000074796
AA Change: V855D

DomainStartEndE-ValueType
SCOP:d1a3aa_ 199 276 5e-5 SMART
Pfam:HCO3_cotransp 308 806 9.7e-153 PFAM
transmembrane domain 827 844 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103193
SMART Domains Protein: ENSMUSP00000099482
Gene: ENSMUSG00000074797

DomainStartEndE-ValueType
Pfam:Ham1p_like 10 188 4.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144945
Meta Mutation Damage Score 0.1744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-regulated, electrogenic sodium-coupled borate cotransporter that is essential for borate homeostasis, cell growth and cell proliferation. Mutations in this gene have been associated with a number of endothelial corneal dystrophies including recessive corneal endothelial dystrophy 2, corneal dystrophy and perceptive deafness, and Fuchs endothelial corneal dystrophy. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele show a collapsed vestibular labyrinth, reduced brainstem auditory potentials, and altered corneal epithelium. Mice homozygous for a reporter allele show corneal endothelial dystrophy, polyuria, natriuresis, urinehypoosmolarity and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Slc4a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Slc4a11 APN 2 130688138 missense probably benign 0.11
IGL01292:Slc4a11 APN 2 130690832 critical splice donor site probably null
IGL01330:Slc4a11 APN 2 130687682 missense probably benign 0.11
IGL01349:Slc4a11 APN 2 130686943 missense probably benign 0.33
IGL01474:Slc4a11 APN 2 130685544 missense probably damaging 1.00
IGL01528:Slc4a11 APN 2 130685408 unclassified probably benign
IGL01752:Slc4a11 APN 2 130688145 missense probably damaging 1.00
IGL01859:Slc4a11 APN 2 130684994 missense probably damaging 1.00
IGL01914:Slc4a11 APN 2 130687279 missense probably damaging 1.00
IGL02367:Slc4a11 APN 2 130684959 missense probably damaging 1.00
IGL02373:Slc4a11 APN 2 130684898 missense probably benign 0.07
IGL02516:Slc4a11 APN 2 130691393 missense possibly damaging 0.89
IGL02894:Slc4a11 APN 2 130687155 splice site probably null
R0029:Slc4a11 UTSW 2 130688054 missense probably damaging 1.00
R0077:Slc4a11 UTSW 2 130686301 unclassified probably benign
R0270:Slc4a11 UTSW 2 130690932 missense possibly damaging 0.89
R0502:Slc4a11 UTSW 2 130688157 missense probably damaging 1.00
R1316:Slc4a11 UTSW 2 130686151 missense probably benign 0.01
R1628:Slc4a11 UTSW 2 130687127 splice site probably null
R1859:Slc4a11 UTSW 2 130688012 missense probably benign 0.00
R2235:Slc4a11 UTSW 2 130685624 missense probably benign 0.19
R2247:Slc4a11 UTSW 2 130687801 missense probably benign 0.00
R3840:Slc4a11 UTSW 2 130688054 missense probably damaging 1.00
R3890:Slc4a11 UTSW 2 130685785 missense probably damaging 0.98
R4296:Slc4a11 UTSW 2 130685007 missense probably benign 0.01
R4304:Slc4a11 UTSW 2 130688138 missense probably benign 0.11
R4749:Slc4a11 UTSW 2 130690867 missense probably damaging 1.00
R4927:Slc4a11 UTSW 2 130684946 missense probably damaging 0.99
R4939:Slc4a11 UTSW 2 130684868 missense probably damaging 1.00
R5756:Slc4a11 UTSW 2 130687863 missense probably benign 0.13
R5869:Slc4a11 UTSW 2 130684459 missense probably benign 0.04
R5905:Slc4a11 UTSW 2 130685052 missense probably damaging 1.00
R6709:Slc4a11 UTSW 2 130684696 missense probably damaging 1.00
R7337:Slc4a11 UTSW 2 130685532 missense probably damaging 1.00
R7909:Slc4a11 UTSW 2 130692300 missense probably benign
R8881:Slc4a11 UTSW 2 130685537 missense probably damaging 0.96
R8889:Slc4a11 UTSW 2 130687220 missense probably damaging 1.00
R8892:Slc4a11 UTSW 2 130687220 missense probably damaging 1.00
R9006:Slc4a11 UTSW 2 130690853 missense probably damaging 0.99
R9038:Slc4a11 UTSW 2 130691743 missense probably damaging 1.00
R9162:Slc4a11 UTSW 2 130692294 missense possibly damaging 0.80
R9239:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9240:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9241:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9323:Slc4a11 UTSW 2 130686910 missense possibly damaging 0.95
R9361:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9363:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9418:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9419:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9420:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9421:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9426:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
R9431:Slc4a11 UTSW 2 130691744 missense probably damaging 1.00
Z1177:Slc4a11 UTSW 2 130691635 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGTGTTTCTGACCCCAAACTG -3'
(R):5'- ACATGAAGATGGTCTTTCCCCTC -3'

Sequencing Primer
(F):5'- CCCCAAACTGAATGTTAACAGGGTG -3'
(R):5'- GAAGATGGTCTTTCCCCTCATCATG -3'
Posted On 2014-10-30