Mutagenetix > Incidental Mutations

Incidental Mutation 'R2332:Slc4a11'

246454

Institutional Source

Beutler Lab

Gene Symbol

Slc4a11

Ensembl Gene

ENSMUSG00000074796

Gene Name

solute carrier family 4, sodium bicarbonate transporter-like, member 11

Synonyms

MMRRC Submission

040322-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.472) question?

Stock #

R2332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130684113-130697519 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 130684459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 855 (V855D)

Ref Sequence

ENSEMBL: ENSMUSP00000096963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099362] [ENSMUST00000103193]

AlphaFold

A2AJN7

Predicted Effect

probably benign
Transcript: ENSMUST00000099362
AA Change: V855D

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000096963
Gene: ENSMUSG00000074796
AA Change: V855D

Domain	Start	End	E-Value	Type
SCOP:d1a3aa_	199	276	5e-5	SMART
Pfam:HCO3_cotransp	308	806	9.7e-153	PFAM
transmembrane domain	827	844	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103193

SMART Domains

Protein: ENSMUSP00000099482
Gene: ENSMUSG00000074797

Domain	Start	End	E-Value	Type
Pfam:Ham1p_like	10	188	4.3e-54	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126714

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144945

Meta Mutation Damage Score

0.1744

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-regulated, electrogenic sodium-coupled borate cotransporter that is essential for borate homeostasis, cell growth and cell proliferation. Mutations in this gene have been associated with a number of endothelial corneal dystrophies including recessive corneal endothelial dystrophy 2, corneal dystrophy and perceptive deafness, and Fuchs endothelial corneal dystrophy. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele show a collapsed vestibular labyrinth, reduced brainstem auditory potentials, and altered corneal epithelium. Mice homozygous for a reporter allele show corneal endothelial dystrophy, polyuria, natriuresis, urinehypoosmolarity and impaired hearing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	C	18: 34,317,059	I2302T	possibly damaging	Het
Apoa4	G	A	9: 46,242,355	V85I	probably benign	Het
Banf1	C	T	19: 5,365,030	W84*	probably null	Het
Cdk13	A	G	13: 17,718,695	L627P	probably damaging	Het
Cep250	A	G	2: 155,990,607	E1483G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ddx60	A	G	8: 62,037,091	E1698G	probably benign	Het
Depdc1a	C	A	3: 159,523,866	Q612K	probably damaging	Het
Dnaja2	G	A	8: 85,540,136	R321C	probably damaging	Het
Fam186b	T	A	15: 99,280,428	E339V	probably benign	Het
Fga	T	C	3: 83,031,397	F360L	probably damaging	Het
Fut9	C	T	4: 25,619,823	W330*	probably null	Het
Ghr	T	C	15: 3,320,409	N429S	probably benign	Het
Gm5444	A	T	13: 4,833,625		noncoding transcript	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hoxa5	T	C	6: 52,202,679	I239V	probably damaging	Het
Hps6	T	C	19: 46,004,491	V289A	possibly damaging	Het
Iqcb1	A	G	16: 36,843,439	N190D	possibly damaging	Het
Map3k13	G	A	16: 21,898,677		probably null	Het
Olfr1115	T	C	2: 87,252,873	V312A	possibly damaging	Het
Olfr607	A	G	7: 103,461,086	Y41H	probably damaging	Het
Pacsin1	A	G	17: 27,704,911	E93G	possibly damaging	Het
Pds5a	A	G	5: 65,627,079		probably null	Het
Ppp1r9b	A	T	11: 94,996,609	E482D	probably damaging	Het
Rhobtb3	A	G	13: 75,910,852	S276P	probably benign	Het
Rimbp2	A	G	5: 128,789,641	V538A	probably benign	Het
Rmdn3	A	T	2: 119,153,527		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Speer4f1	C	A	5: 17,479,524	N183K	probably damaging	Het
Sstr4	A	T	2: 148,396,410	N314Y	probably damaging	Het
Synj2	A	G	17: 6,023,794	K288E	probably damaging	Het
Trhde	T	A	10: 114,592,165	N409Y	probably damaging	Het
Ttn	A	T	2: 76,781,139	W15604R	probably damaging	Het
Ugdh	C	T	5: 65,427,484	V32I	possibly damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vps13d	G	T	4: 145,148,686	D1750E	probably benign	Het
Wdfy3	A	G	5: 101,888,323		probably benign	Het
Wnt4	C	A	4: 137,296,520	T266K	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp322a	A	T	13: 23,357,324	C83S	probably damaging	Het

Other mutations in Slc4a11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Slc4a11	APN	2	130688138	missense	probably benign	0.11
IGL01292:Slc4a11	APN	2	130690832	critical splice donor site	probably null
IGL01330:Slc4a11	APN	2	130687682	missense	probably benign	0.11
IGL01349:Slc4a11	APN	2	130686943	missense	probably benign	0.33
IGL01474:Slc4a11	APN	2	130685544	missense	probably damaging	1.00
IGL01528:Slc4a11	APN	2	130685408	unclassified	probably benign
IGL01752:Slc4a11	APN	2	130688145	missense	probably damaging	1.00
IGL01859:Slc4a11	APN	2	130684994	missense	probably damaging	1.00
IGL01914:Slc4a11	APN	2	130687279	missense	probably damaging	1.00
IGL02367:Slc4a11	APN	2	130684959	missense	probably damaging	1.00
IGL02373:Slc4a11	APN	2	130684898	missense	probably benign	0.07
IGL02516:Slc4a11	APN	2	130691393	missense	possibly damaging	0.89
IGL02894:Slc4a11	APN	2	130687155	splice site	probably null
R0029:Slc4a11	UTSW	2	130688054	missense	probably damaging	1.00
R0077:Slc4a11	UTSW	2	130686301	unclassified	probably benign
R0270:Slc4a11	UTSW	2	130690932	missense	possibly damaging	0.89
R0502:Slc4a11	UTSW	2	130688157	missense	probably damaging	1.00
R1316:Slc4a11	UTSW	2	130686151	missense	probably benign	0.01
R1628:Slc4a11	UTSW	2	130687127	splice site	probably null
R1859:Slc4a11	UTSW	2	130688012	missense	probably benign	0.00
R2235:Slc4a11	UTSW	2	130685624	missense	probably benign	0.19
R2247:Slc4a11	UTSW	2	130687801	missense	probably benign	0.00
R3840:Slc4a11	UTSW	2	130688054	missense	probably damaging	1.00
R3890:Slc4a11	UTSW	2	130685785	missense	probably damaging	0.98
R4296:Slc4a11	UTSW	2	130685007	missense	probably benign	0.01
R4304:Slc4a11	UTSW	2	130688138	missense	probably benign	0.11
R4749:Slc4a11	UTSW	2	130690867	missense	probably damaging	1.00
R4927:Slc4a11	UTSW	2	130684946	missense	probably damaging	0.99
R4939:Slc4a11	UTSW	2	130684868	missense	probably damaging	1.00
R5756:Slc4a11	UTSW	2	130687863	missense	probably benign	0.13
R5869:Slc4a11	UTSW	2	130684459	missense	probably benign	0.04
R5905:Slc4a11	UTSW	2	130685052	missense	probably damaging	1.00
R6709:Slc4a11	UTSW	2	130684696	missense	probably damaging	1.00
R7337:Slc4a11	UTSW	2	130685532	missense	probably damaging	1.00
R7909:Slc4a11	UTSW	2	130692300	missense	probably benign
R8881:Slc4a11	UTSW	2	130685537	missense	probably damaging	0.96
R8889:Slc4a11	UTSW	2	130687220	missense	probably damaging	1.00
R8892:Slc4a11	UTSW	2	130687220	missense	probably damaging	1.00
R9006:Slc4a11	UTSW	2	130690853	missense	probably damaging	0.99
R9038:Slc4a11	UTSW	2	130691743	missense	probably damaging	1.00
R9162:Slc4a11	UTSW	2	130692294	missense	possibly damaging	0.80
R9239:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9240:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9241:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9323:Slc4a11	UTSW	2	130686910	missense	possibly damaging	0.95
R9361:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9363:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9418:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9419:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9420:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9421:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9426:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
R9431:Slc4a11	UTSW	2	130691744	missense	probably damaging	1.00
Z1177:Slc4a11	UTSW	2	130691635	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CAGTGTTTCTGACCCCAAACTG -3'
(R):5'- ACATGAAGATGGTCTTTCCCCTC -3'

Sequencing Primer
(F):5'- CCCCAAACTGAATGTTAACAGGGTG -3'
(R):5'- GAAGATGGTCTTTCCCCTCATCATG -3'

Posted On

2014-10-30