Incidental Mutation 'R2332:Depdc1a'
ID 246458
Institutional Source Beutler Lab
Gene Symbol Depdc1a
Ensembl Gene ENSMUSG00000028175
Gene Name DEP domain containing 1a
Synonyms 5830484J08Rik
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 159495433-159529955 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 159523866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 612 (Q612K)
Ref Sequence ENSEMBL: ENSMUSP00000113216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029825] [ENSMUST00000106041] [ENSMUST00000120272]
AlphaFold Q8CIG0
Predicted Effect probably damaging
Transcript: ENSMUST00000029825
AA Change: Q612K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029825
Gene: ENSMUSG00000028175
AA Change: Q612K

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 3e-9 SMART
low complexity region 745 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106041
AA Change: Q335K

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101656
Gene: ENSMUSG00000028175
AA Change: Q335K

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
Pfam:RhoGAP 251 357 2.3e-11 PFAM
coiled coil region 460 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120272
AA Change: Q612K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113216
Gene: ENSMUSG00000028175
AA Change: Q612K

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 4e-9 SMART
coiled coil region 737 765 N/A INTRINSIC
Meta Mutation Damage Score 0.2937 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Depdc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Depdc1a APN 3 159522738 nonsense probably null
IGL00581:Depdc1a APN 3 159526552 missense probably benign 0.12
IGL00961:Depdc1a APN 3 159523814 missense possibly damaging 0.79
IGL01530:Depdc1a APN 3 159523923 missense probably damaging 1.00
IGL01567:Depdc1a APN 3 159526546 missense probably damaging 1.00
IGL02320:Depdc1a APN 3 159516933 missense probably damaging 0.99
IGL02622:Depdc1a APN 3 159515510 missense probably benign 0.02
IGL02647:Depdc1a APN 3 159522866 missense probably damaging 1.00
P0033:Depdc1a UTSW 3 159516141 missense probably damaging 0.99
P4717OSA:Depdc1a UTSW 3 159522547 missense probably damaging 1.00
P4748:Depdc1a UTSW 3 159522547 missense probably damaging 1.00
R0220:Depdc1a UTSW 3 159523905 missense probably benign 0.06
R0454:Depdc1a UTSW 3 159516900 splice site probably null
R0479:Depdc1a UTSW 3 159520860 missense probably damaging 1.00
R1317:Depdc1a UTSW 3 159523287 missense probably damaging 1.00
R1452:Depdc1a UTSW 3 159526691 missense possibly damaging 0.88
R1567:Depdc1a UTSW 3 159522540 missense possibly damaging 0.86
R1669:Depdc1a UTSW 3 159522924 missense probably benign 0.07
R1751:Depdc1a UTSW 3 159523287 missense probably damaging 1.00
R4023:Depdc1a UTSW 3 159516149 splice site probably null
R4254:Depdc1a UTSW 3 159498487 missense probably damaging 0.99
R4551:Depdc1a UTSW 3 159522584 missense probably damaging 1.00
R4780:Depdc1a UTSW 3 159526706 missense probably benign 0.00
R4782:Depdc1a UTSW 3 159526636 missense probably damaging 1.00
R4866:Depdc1a UTSW 3 159516127 missense probably damaging 0.96
R4981:Depdc1a UTSW 3 159523913 missense probably benign 0.14
R5100:Depdc1a UTSW 3 159515520 missense probably benign 0.06
R5326:Depdc1a UTSW 3 159526649 missense probably damaging 1.00
R5367:Depdc1a UTSW 3 159523954 splice site probably null
R5892:Depdc1a UTSW 3 159526669 missense probably damaging 1.00
R6314:Depdc1a UTSW 3 159498414 missense probably damaging 1.00
R6467:Depdc1a UTSW 3 159516042 missense probably benign 0.00
R6674:Depdc1a UTSW 3 159526707 missense probably benign 0.00
R7061:Depdc1a UTSW 3 159522852 missense possibly damaging 0.74
R7366:Depdc1a UTSW 3 159523212 missense probably benign 0.00
R7531:Depdc1a UTSW 3 159522639 missense probably damaging 1.00
R7886:Depdc1a UTSW 3 159516069 missense probably benign 0.04
R7981:Depdc1a UTSW 3 159520851 missense probably benign 0.00
R8335:Depdc1a UTSW 3 159523222 missense probably damaging 1.00
R8488:Depdc1a UTSW 3 159523875 missense probably damaging 0.96
R8560:Depdc1a UTSW 3 159514275 missense probably damaging 1.00
R8725:Depdc1a UTSW 3 159522719 missense probably benign 0.03
R8727:Depdc1a UTSW 3 159522719 missense probably benign 0.03
R9096:Depdc1a UTSW 3 159498480 missense probably benign 0.00
R9097:Depdc1a UTSW 3 159498480 missense probably benign 0.00
R9360:Depdc1a UTSW 3 159526531 missense possibly damaging 0.90
X0026:Depdc1a UTSW 3 159498631 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTGATCTGTGTCACTTTGTTTTAT -3'
(R):5'- CGATGTAGAGATCAGGGAGAACTTG -3'

Sequencing Primer
(F):5'- ACTTAGAAATAAGTTGC -3'
(R):5'- ATGGTTGCCTGTACAAGACC -3'
Posted On 2014-10-30