Incidental Mutation 'R2332:Fut9'
ID 246459
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFuc-TIX, mFUT9
MMRRC Submission 040322-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 25609332-25800244 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 25619823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 330 (W330*)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably null
Transcript: ENSMUST00000084770
AA Change: W330*
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: W330*

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108199
AA Change: W330*
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: W330*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25620316 missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25620446 missense probably benign 0.13
IGL01330:Fut9 APN 4 25619791 missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25619867 missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25620037 missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25620802 missense probably benign 0.25
R0280:Fut9 UTSW 4 25619852 missense probably benign 0.00
R0408:Fut9 UTSW 4 25620319 missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25620526 missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25620811 start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25620359 missense probably damaging 1.00
R1567:Fut9 UTSW 4 25620344 missense probably damaging 0.99
R1719:Fut9 UTSW 4 25619744 missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25620352 missense probably damaging 1.00
R2036:Fut9 UTSW 4 25620322 missense probably damaging 1.00
R2165:Fut9 UTSW 4 25619733 makesense probably null
R2165:Fut9 UTSW 4 25619734 makesense probably null
R4539:Fut9 UTSW 4 25619793 missense probably damaging 1.00
R4722:Fut9 UTSW 4 25799734 utr 5 prime probably benign
R4766:Fut9 UTSW 4 25799191 intron probably benign
R4937:Fut9 UTSW 4 25799591 splice site probably benign
R5025:Fut9 UTSW 4 25620502 missense probably damaging 1.00
R5032:Fut9 UTSW 4 25799245 intron probably benign
R5158:Fut9 UTSW 4 25620731 missense probably benign 0.01
R5601:Fut9 UTSW 4 25620299 missense probably benign 0.00
R5974:Fut9 UTSW 4 25620090 nonsense probably null
R6315:Fut9 UTSW 4 25619774 missense probably damaging 1.00
R6385:Fut9 UTSW 4 25620328 missense probably damaging 1.00
R6652:Fut9 UTSW 4 25620619 missense probably benign 0.44
R6809:Fut9 UTSW 4 25620647 missense probably benign
R6825:Fut9 UTSW 4 25619925 missense probably benign
R7145:Fut9 UTSW 4 25620507 missense probably damaging 0.96
R7573:Fut9 UTSW 4 25620691 missense probably benign 0.04
R8933:Fut9 UTSW 4 25619861 missense probably damaging 1.00
R9715:Fut9 UTSW 4 25620679 missense probably benign 0.00
X0057:Fut9 UTSW 4 25799686 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AATATACATGGTCCTCAAGGGAG -3'
(R):5'- CTGTTGTCCTGGGTCCATCTAG -3'

Sequencing Primer
(F):5'- TTAAACGGTGCCCCAAATGCAG -3'
(R):5'- TCCTGGGTCCATCTAGGGAAAAC -3'
Posted On 2014-10-30