Incidental Mutation 'R2332:Wnt4'
ID 246461
Institutional Source Beutler Lab
Gene Symbol Wnt4
Ensembl Gene ENSMUSG00000036856
Gene Name wingless-type MMTV integration site family, member 4
Synonyms Wnt-4
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 137277489-137299726 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 137296520 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 266 (T266K)
Ref Sequence ENSEMBL: ENSMUSP00000036580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045747]
AlphaFold P22724
Predicted Effect probably benign
Transcript: ENSMUST00000045747
AA Change: T266K

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036580
Gene: ENSMUSG00000036856
AA Change: T266K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
WNT1 45 350 1.7e-211 SMART
Meta Mutation Damage Score 0.1119 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and is the first signaling molecule shown to influence the sex-determination cascade. It encodes a protein which shows 98% amino acid identity to the Wnt4 protein of mouse and rat. This gene and a nuclear receptor known to antagonize the testis-determining factor play a concerted role in both the control of female development and the prevention of testes formation. This gene and another two family members, WNT2 and WNT7B, may be associated with abnormal proliferation in breast tissue. Mutations in this gene can result in Rokitansky-Kuster-Hauser syndrome and in SERKAL syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit impaired development of the kidney, pituitary gland, and female reproductive system. Mutants die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Wnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03037:Wnt4 APN 4 137289161 missense possibly damaging 0.93
R0328:Wnt4 UTSW 4 137295443 missense probably damaging 0.99
R0791:Wnt4 UTSW 4 137289283 missense probably damaging 1.00
R4206:Wnt4 UTSW 4 137296343 missense possibly damaging 0.91
R5269:Wnt4 UTSW 4 137277750 missense probably benign 0.00
X0064:Wnt4 UTSW 4 137277746 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATCTTGACACACATGCGGGTG -3'
(R):5'- TTGACGAAGCAGCACCAGTG -3'

Sequencing Primer
(F):5'- TGGAGTGCAAGTGTCACG -3'
(R):5'- AGCAGCACCAGTGGAACCTG -3'
Posted On 2014-10-30