Incidental Mutation 'R2332:Ugdh'
ID 246464
Institutional Source Beutler Lab
Gene Symbol Ugdh
Ensembl Gene ENSMUSG00000029201
Gene Name UDP-glucose dehydrogenase
Synonyms Udpgdh
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 65413221-65435949 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65427484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 32 (V32I)
Ref Sequence ENSEMBL: ENSMUSP00000118999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031103] [ENSMUST00000131263] [ENSMUST00000196121]
AlphaFold O70475
Predicted Effect possibly damaging
Transcript: ENSMUST00000031103
AA Change: V32I

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031103
Gene: ENSMUSG00000029201
AA Change: V32I

DomainStartEndE-ValueType
Pfam:UDPG_MGDP_dh_N 5 195 1.5e-63 PFAM
Pfam:UDPG_MGDP_dh 214 309 1.8e-34 PFAM
UDPG_MGDP_dh_C 332 447 1.89e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125375
Predicted Effect possibly damaging
Transcript: ENSMUST00000131263
AA Change: V32I

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118999
Gene: ENSMUSG00000029201
AA Change: V32I

DomainStartEndE-ValueType
Pfam:UDPG_MGDP_dh_N 5 157 4e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139402
Predicted Effect probably benign
Transcript: ENSMUST00000196121
SMART Domains Protein: ENSMUSP00000143665
Gene: ENSMUSG00000105835

DomainStartEndE-ValueType
Pfam:UDPG_MGDP_dh_N 5 50 6.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200537
Meta Mutation Damage Score 0.3182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene converts UDP-glucose to UDP-glucuronate and thereby participates in the biosynthesis of glycosaminoglycans such as hyaluronan, chondroitin sulfate, and heparan sulfate. These glycosylated compounds are common components of the extracellular matrix and likely play roles in signal transduction, cell migration, and cancer growth and metastasis. The expression of this gene is up-regulated by transforming growth factor beta and down-regulated by hypoxia. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mutation of this gene results in developmental arrest during gastrulation with defects in endoderm and mesoderm migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Ugdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Ugdh APN 5 65416905 missense probably benign 0.12
IGL01734:Ugdh APN 5 65422688 missense probably benign
IGL02157:Ugdh APN 5 65422692 missense probably damaging 0.99
R1677:Ugdh UTSW 5 65423178 missense probably damaging 1.00
R1836:Ugdh UTSW 5 65420291 nonsense probably null
R1882:Ugdh UTSW 5 65423596 missense possibly damaging 0.86
R2020:Ugdh UTSW 5 65416925 missense probably damaging 1.00
R2166:Ugdh UTSW 5 65417014 splice site probably benign
R2256:Ugdh UTSW 5 65417115 splice site probably benign
R2257:Ugdh UTSW 5 65417115 splice site probably benign
R4707:Ugdh UTSW 5 65423352 splice site probably null
R4913:Ugdh UTSW 5 65423448 critical splice donor site probably null
R5590:Ugdh UTSW 5 65422874 unclassified probably benign
R5644:Ugdh UTSW 5 65416861 missense probably benign 0.04
R5741:Ugdh UTSW 5 65427523 missense probably damaging 0.99
R6151:Ugdh UTSW 5 65417581 nonsense probably null
R6525:Ugdh UTSW 5 65417059 missense probably damaging 1.00
R6897:Ugdh UTSW 5 65427433 missense probably benign 0.07
R7155:Ugdh UTSW 5 65417037 missense probably damaging 1.00
R7692:Ugdh UTSW 5 65417615 missense probably damaging 1.00
R8178:Ugdh UTSW 5 65423662 splice site probably null
R8485:Ugdh UTSW 5 65427559 missense possibly damaging 0.50
R9361:Ugdh UTSW 5 65418543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTTTCTTCATTGACTTGGTGG -3'
(R):5'- AGGAAATGTCTCCAGATACCTGAC -3'

Sequencing Primer
(F):5'- GTGGCATGTCATAGATTGCAC -3'
(R):5'- CAGATACCTGACACTTCTGTGATG -3'
Posted On 2014-10-30