Mutagenetix > Incidental Mutations

Incidental Mutation 'R2332:Pds5a'

246465

Institutional Source

Beutler Lab

Gene Symbol

Pds5a

Ensembl Gene

ENSMUSG00000029202

Gene Name

PDS5 cohesin associated factor A

Synonyms

9030416H16Rik, E230024D05Rik

MMRRC Submission

040322-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65605721-65698273 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 65627079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031104] [ENSMUST00000031104] [ENSMUST00000201948] [ENSMUST00000201948]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000031104

SMART Domains

Protein: ENSMUSP00000031104
Gene: ENSMUSG00000029202

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	253	782	6e-30	SMART
low complexity region	934	946	N/A	INTRINSIC
low complexity region	1174	1190	N/A	INTRINSIC
low complexity region	1258	1276	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000031104

SMART Domains

Protein: ENSMUSP00000031104
Gene: ENSMUSG00000029202

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	253	782	6e-30	SMART
low complexity region	934	946	N/A	INTRINSIC
low complexity region	1174	1190	N/A	INTRINSIC
low complexity region	1258	1276	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200766

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201420

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201770

Predicted Effect

probably null
Transcript: ENSMUST00000201948

SMART Domains

Protein: ENSMUSP00000144171
Gene: ENSMUSG00000029202

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	253	782	6e-30	SMART
low complexity region	934	946	N/A	INTRINSIC
low complexity region	1174	1190	N/A	INTRINSIC
low complexity region	1258	1276	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000201948

SMART Domains

Protein: ENSMUSP00000144171
Gene: ENSMUSG00000029202

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	253	782	6e-30	SMART
low complexity region	934	946	N/A	INTRINSIC
low complexity region	1174	1190	N/A	INTRINSIC
low complexity region	1258	1276	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201987

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202910

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the cohesin complex and associates with chromatin through most of the cell cycle. The encoded protein may play a role in regulating sister chromatid cohesion during mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with respiratory distress, abnormal heart development, abnormal skeletal development, kidney agenesis, and delayed enteric nervous system development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	C	18: 34,317,059	I2302T	possibly damaging	Het
Apoa4	G	A	9: 46,242,355	V85I	probably benign	Het
Banf1	C	T	19: 5,365,030	W84*	probably null	Het
Cdk13	A	G	13: 17,718,695	L627P	probably damaging	Het
Cep250	A	G	2: 155,990,607	E1483G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ddx60	A	G	8: 62,037,091	E1698G	probably benign	Het
Depdc1a	C	A	3: 159,523,866	Q612K	probably damaging	Het
Dnaja2	G	A	8: 85,540,136	R321C	probably damaging	Het
Fam186b	T	A	15: 99,280,428	E339V	probably benign	Het
Fga	T	C	3: 83,031,397	F360L	probably damaging	Het
Fut9	C	T	4: 25,619,823	W330*	probably null	Het
Ghr	T	C	15: 3,320,409	N429S	probably benign	Het
Gm5444	A	T	13: 4,833,625		noncoding transcript	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hoxa5	T	C	6: 52,202,679	I239V	probably damaging	Het
Hps6	T	C	19: 46,004,491	V289A	possibly damaging	Het
Iqcb1	A	G	16: 36,843,439	N190D	possibly damaging	Het
Map3k13	G	A	16: 21,898,677		probably null	Het
Olfr1115	T	C	2: 87,252,873	V312A	possibly damaging	Het
Olfr607	A	G	7: 103,461,086	Y41H	probably damaging	Het
Pacsin1	A	G	17: 27,704,911	E93G	possibly damaging	Het
Ppp1r9b	A	T	11: 94,996,609	E482D	probably damaging	Het
Rhobtb3	A	G	13: 75,910,852	S276P	probably benign	Het
Rimbp2	A	G	5: 128,789,641	V538A	probably benign	Het
Rmdn3	A	T	2: 119,153,527		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Slc4a11	A	T	2: 130,684,459	V855D	probably benign	Het
Speer4f1	C	A	5: 17,479,524	N183K	probably damaging	Het
Sstr4	A	T	2: 148,396,410	N314Y	probably damaging	Het
Synj2	A	G	17: 6,023,794	K288E	probably damaging	Het
Trhde	T	A	10: 114,592,165	N409Y	probably damaging	Het
Ttn	A	T	2: 76,781,139	W15604R	probably damaging	Het
Ugdh	C	T	5: 65,427,484	V32I	possibly damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vps13d	G	T	4: 145,148,686	D1750E	probably benign	Het
Wdfy3	A	G	5: 101,888,323		probably benign	Het
Wnt4	C	A	4: 137,296,520	T266K	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp322a	A	T	13: 23,357,324	C83S	probably damaging	Het

Other mutations in Pds5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Pds5a	APN	5	65656344	missense	probably damaging	1.00
IGL00979:Pds5a	APN	5	65631723	missense	probably benign	0.22
IGL01314:Pds5a	APN	5	65615294	missense	probably benign
IGL02449:Pds5a	APN	5	65619010	missense	probably damaging	1.00
IGL02539:Pds5a	APN	5	65666119	missense	probably damaging	1.00
IGL03395:Pds5a	APN	5	65652449	missense	possibly damaging	0.61
R0569:Pds5a	UTSW	5	65656401	missense	probably damaging	1.00
R0704:Pds5a	UTSW	5	65620585	missense	probably damaging	1.00
R1170:Pds5a	UTSW	5	65635302	splice site	probably benign
R1181:Pds5a	UTSW	5	65627202	splice site	probably null
R1193:Pds5a	UTSW	5	65637802	missense	probably damaging	1.00
R1537:Pds5a	UTSW	5	65647121	missense	probably benign	0.09
R1853:Pds5a	UTSW	5	65624029	missense	possibly damaging	0.56
R2016:Pds5a	UTSW	5	65648007	critical splice acceptor site	probably null
R2154:Pds5a	UTSW	5	65650498	missense	probably damaging	1.00
R2209:Pds5a	UTSW	5	65628014	nonsense	probably null
R2234:Pds5a	UTSW	5	65654098	missense	probably damaging	1.00
R2235:Pds5a	UTSW	5	65654098	missense	probably damaging	1.00
R3114:Pds5a	UTSW	5	65618985	missense	probably damaging	1.00
R3417:Pds5a	UTSW	5	65637892	missense	probably damaging	0.99
R3820:Pds5a	UTSW	5	65654076	missense	possibly damaging	0.94
R4152:Pds5a	UTSW	5	65666171	nonsense	probably null
R4159:Pds5a	UTSW	5	65664496	missense	possibly damaging	0.75
R4160:Pds5a	UTSW	5	65664496	missense	possibly damaging	0.75
R4161:Pds5a	UTSW	5	65664496	missense	possibly damaging	0.75
R4230:Pds5a	UTSW	5	65629986	missense	possibly damaging	0.85
R4491:Pds5a	UTSW	5	65635437	missense	probably benign
R4647:Pds5a	UTSW	5	65656318	missense	probably damaging	1.00
R4816:Pds5a	UTSW	5	65651289	missense	probably damaging	1.00
R4867:Pds5a	UTSW	5	65644120	missense	probably damaging	1.00
R5001:Pds5a	UTSW	5	65696785	missense	probably damaging	0.99
R5013:Pds5a	UTSW	5	65635337	missense	probably benign	0.05
R5054:Pds5a	UTSW	5	65637814	missense	probably damaging	1.00
R5068:Pds5a	UTSW	5	65615272	missense	probably damaging	0.99
R5178:Pds5a	UTSW	5	65663875	missense	probably damaging	1.00
R5269:Pds5a	UTSW	5	65663928	missense	probably damaging	1.00
R5396:Pds5a	UTSW	5	65638577	missense	probably benign	0.09
R5704:Pds5a	UTSW	5	65627079	splice site	probably null
R5940:Pds5a	UTSW	5	65643985	intron	probably benign
R6306:Pds5a	UTSW	5	65656296	missense	probably damaging	1.00
R6322:Pds5a	UTSW	5	65696834	missense	probably benign	0.00
R6467:Pds5a	UTSW	5	65652439	missense	probably damaging	1.00
R6476:Pds5a	UTSW	5	65634287	missense	possibly damaging	0.94
R6513:Pds5a	UTSW	5	65615601	missense	probably benign	0.18
R7304:Pds5a	UTSW	5	65619734	missense	probably damaging	1.00
R7312:Pds5a	UTSW	5	65666227	missense	possibly damaging	0.81
R7438:Pds5a	UTSW	5	65652535	critical splice acceptor site	probably null
R7637:Pds5a	UTSW	5	65638604	missense	probably benign	0.12
R7654:Pds5a	UTSW	5	65618981	missense	probably damaging	1.00
R7707:Pds5a	UTSW	5	65610133	missense	unknown
R7715:Pds5a	UTSW	5	65638561	missense	possibly damaging	0.96
R7748:Pds5a	UTSW	5	65619666	missense	possibly damaging	0.93
R7910:Pds5a	UTSW	5	65638582	missense	possibly damaging	0.85
R8014:Pds5a	UTSW	5	65627739	missense	possibly damaging	0.56
R8023:Pds5a	UTSW	5	65637898	missense	probably damaging	1.00
R8070:Pds5a	UTSW	5	65652398	missense	possibly damaging	0.92
R8190:Pds5a	UTSW	5	65623998	missense	probably damaging	1.00
R8406:Pds5a	UTSW	5	65646338	missense	probably benign	0.02
R9074:Pds5a	UTSW	5	65647136	missense	possibly damaging	0.86
R9222:Pds5a	UTSW	5	65647938	missense	probably benign	0.42
R9390:Pds5a	UTSW	5	65666257	missense	probably benign	0.39
R9404:Pds5a	UTSW	5	65618964	missense	probably damaging	0.99
Z1088:Pds5a	UTSW	5	65618986	missense	probably damaging	1.00
Z1176:Pds5a	UTSW	5	65659727	missense	possibly damaging	0.75
Z1177:Pds5a	UTSW	5	65651212	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CCATGAGGAGAAATTTTCATCAGTT -3'
(R):5'- GTAGCCAACTATTAATAGCTAAGGGAA -3'

Sequencing Primer
(F):5'- GAGGGCTAAGAATAGTTCTG -3'
(R):5'- AATAGAAGCAAACGGTTAGAACTC -3'

Posted On

2014-10-30