Incidental Mutation 'R2332:Rimbp2'
ID246467
Institutional Source Beutler Lab
Gene Symbol Rimbp2
Ensembl Gene ENSMUSG00000029420
Gene NameRIMS binding protein 2
Synonyms
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2332 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location128757791-128953486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128789641 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 538 (V538A)
Ref Sequence ENSEMBL: ENSMUSP00000143276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111346] [ENSMUST00000196085] [ENSMUST00000198941] [ENSMUST00000199537] [ENSMUST00000200470]
Predicted Effect probably benign
Transcript: ENSMUST00000111346
AA Change: V545A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106978
Gene: ENSMUSG00000029420
AA Change: V545A

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000196085
AA Change: V545A
SMART Domains Protein: ENSMUSP00000143725
Gene: ENSMUSG00000029420
AA Change: V545A

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1e-13 SMART
FN3 318 398 7.7e-4 SMART
FN3 412 484 1.7e-5 SMART
FN3 508 594 1.6e-4 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 699 720 N/A INTRINSIC
low complexity region 751 767 N/A INTRINSIC
SH3 803 867 3.2e-13 SMART
SH3 907 970 4.5e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198941
AA Change: V545A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142455
Gene: ENSMUSG00000029420
AA Change: V545A

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199537
AA Change: V538A

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143276
Gene: ENSMUSG00000029420
AA Change: V538A

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 1.61e-11 SMART
FN3 311 391 1.52e-1 SMART
FN3 405 477 3.59e-3 SMART
FN3 501 587 3.08e-2 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 5.24e-11 SMART
SH3 975 1038 7.17e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200470
AA Change: V538A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143099
Gene: ENSMUSG00000029420
AA Change: V538A

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 9.8e-14 SMART
FN3 311 391 7.5e-4 SMART
FN3 405 477 1.7e-5 SMART
FN3 501 587 1.5e-4 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 3.2e-13 SMART
SH3 975 1038 4.4e-20 SMART
Meta Mutation Damage Score 0.6308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Homozygous knockout results in a mild neurological phenotype with changes in the synaptic transmission and plasticity of hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Rimbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Rimbp2 APN 5 128806441 missense probably benign 0.00
IGL01321:Rimbp2 APN 5 128786752 missense probably benign 0.10
IGL01459:Rimbp2 APN 5 128788211 critical splice donor site probably null
IGL01743:Rimbp2 APN 5 128797848 splice site probably benign
IGL01975:Rimbp2 APN 5 128797648 missense probably benign 0.30
IGL02269:Rimbp2 APN 5 128774295 missense probably damaging 1.00
IGL02341:Rimbp2 APN 5 128800961 nonsense probably null
IGL02368:Rimbp2 APN 5 128788154 splice site probably null
IGL02392:Rimbp2 APN 5 128771797 missense probably benign 0.01
IGL03156:Rimbp2 APN 5 128771757 missense probably damaging 1.00
IGL02837:Rimbp2 UTSW 5 128797745 missense probably damaging 0.98
PIT4418001:Rimbp2 UTSW 5 128780361 missense probably benign 0.00
R0193:Rimbp2 UTSW 5 128788356 missense probably benign 0.12
R0376:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0377:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0661:Rimbp2 UTSW 5 128786710 missense probably benign 0.20
R1217:Rimbp2 UTSW 5 128788287 missense probably benign 0.04
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1551:Rimbp2 UTSW 5 128806359 missense probably damaging 0.97
R1883:Rimbp2 UTSW 5 128803934 missense possibly damaging 0.93
R1970:Rimbp2 UTSW 5 128797241 missense probably damaging 1.00
R2111:Rimbp2 UTSW 5 128773501 missense probably damaging 1.00
R2120:Rimbp2 UTSW 5 128788518 missense probably damaging 1.00
R2155:Rimbp2 UTSW 5 128788165 missense probably damaging 0.99
R2370:Rimbp2 UTSW 5 128803844 missense probably damaging 0.99
R2402:Rimbp2 UTSW 5 128784888 missense probably damaging 1.00
R3710:Rimbp2 UTSW 5 128789731 missense probably benign 0.16
R3877:Rimbp2 UTSW 5 128773465 missense probably damaging 1.00
R3974:Rimbp2 UTSW 5 128797798 missense probably damaging 1.00
R4257:Rimbp2 UTSW 5 128774260 missense probably damaging 1.00
R4270:Rimbp2 UTSW 5 128819777 missense probably benign
R4271:Rimbp2 UTSW 5 128819777 missense probably benign
R4281:Rimbp2 UTSW 5 128788340 missense possibly damaging 0.82
R4934:Rimbp2 UTSW 5 128788515 missense probably benign 0.12
R5011:Rimbp2 UTSW 5 128803921 missense probably damaging 0.98
R5173:Rimbp2 UTSW 5 128797648 missense probably benign 0.30
R5288:Rimbp2 UTSW 5 128788592 missense probably benign 0.00
R5305:Rimbp2 UTSW 5 128797381 missense possibly damaging 0.69
R5554:Rimbp2 UTSW 5 128780342 missense probably damaging 0.98
R6189:Rimbp2 UTSW 5 128803897 missense probably benign
R7023:Rimbp2 UTSW 5 128802783 critical splice donor site probably null
R7096:Rimbp2 UTSW 5 128774269 missense probably damaging 0.99
R7451:Rimbp2 UTSW 5 128788371 missense probably benign 0.00
R7789:Rimbp2 UTSW 5 128774335 missense probably damaging 0.99
R7793:Rimbp2 UTSW 5 128789695 missense possibly damaging 0.92
R7894:Rimbp2 UTSW 5 128761464 missense probably damaging 1.00
R7977:Rimbp2 UTSW 5 128761464 missense probably damaging 1.00
Z1177:Rimbp2 UTSW 5 128761339 missense probably benign 0.07
Z1177:Rimbp2 UTSW 5 128773451 missense probably benign 0.01
Z1177:Rimbp2 UTSW 5 128788180 missense probably damaging 1.00
Z1177:Rimbp2 UTSW 5 128797607 missense probably damaging 1.00
Z1177:Rimbp2 UTSW 5 128797631 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATGATGGGACCTCCTCACTC -3'
(R):5'- TCCAAGTTTGACAGACCAAGTG -3'

Sequencing Primer
(F):5'- ACCTGTGGCAGAGGACAGTC -3'
(R):5'- TTTGACAGACCAAGTGAAGAAAGGC -3'
Posted On2014-10-30