Incidental Mutation 'R2332:Hoxa5'
ID 246468
Institutional Source Beutler Lab
Gene Symbol Hoxa5
Ensembl Gene ENSMUSG00000038253
Gene Name homeobox A5
Synonyms Hox-1.3
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.715) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 52201754-52204587 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52202679 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 239 (I239V)
Ref Sequence ENSEMBL: ENSMUSP00000039012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048794] [ENSMUST00000062829] [ENSMUST00000114434] [ENSMUST00000128102]
AlphaFold P09021
Predicted Effect probably damaging
Transcript: ENSMUST00000048794
AA Change: I239V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039012
Gene: ENSMUSG00000038253
AA Change: I239V

DomainStartEndE-ValueType
low complexity region 65 86 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 146 175 N/A INTRINSIC
HOX 195 257 1.63e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062829
SMART Domains Protein: ENSMUSP00000058755
Gene: ENSMUSG00000043219

DomainStartEndE-ValueType
HOX 154 216 2.43e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114434
SMART Domains Protein: ENSMUSP00000110077
Gene: ENSMUSG00000079560

DomainStartEndE-ValueType
low complexity region 76 131 N/A INTRINSIC
HOX 192 254 3.35e-28 SMART
low complexity region 287 302 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Pfam:DUF4074 377 441 9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142764
Meta Mutation Damage Score 0.1069 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Methylation of this gene may result in the loss of its expression and, since the encoded protein upregulates the tumor suppressor p53, this protein may play an important role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show skeletal defects, tracheal and lung dysmorphology, reduced surfactant production, emphysema, and partial neonatal lethality. Survivors show stunted growth, delayed ear elevation and eyelid opening, and altered thyroid development, digestive secretion, and ovarian biology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Hoxa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Hoxa5 APN 6 52204331 missense probably damaging 1.00
IGL01885:Hoxa5 APN 6 52202667 missense probably damaging 1.00
IGL02021:Hoxa5 APN 6 52202657 missense probably damaging 1.00
IGL02631:Hoxa5 APN 6 52203810 missense probably damaging 1.00
IGL02885:Hoxa5 APN 6 52202708 missense probably damaging 1.00
R0377:Hoxa5 UTSW 6 52202646 missense probably damaging 1.00
R0543:Hoxa5 UTSW 6 52204340 missense probably damaging 1.00
R1061:Hoxa5 UTSW 6 52204155 missense probably benign
R1460:Hoxa5 UTSW 6 52203948 missense probably benign 0.00
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1804:Hoxa5 UTSW 6 52202648 missense probably damaging 1.00
R1822:Hoxa5 UTSW 6 52202732 missense probably damaging 1.00
R4303:Hoxa5 UTSW 6 52204260 missense probably benign 0.01
R4796:Hoxa5 UTSW 6 52203963 missense probably benign 0.01
R5642:Hoxa5 UTSW 6 52204217 missense probably damaging 1.00
R6212:Hoxa5 UTSW 6 52202714 missense probably damaging 1.00
R7134:Hoxa5 UTSW 6 52204043 missense probably damaging 1.00
R7172:Hoxa5 UTSW 6 52204296 missense probably damaging 1.00
R8037:Hoxa5 UTSW 6 52204329 missense probably damaging 1.00
R8038:Hoxa5 UTSW 6 52204329 missense probably damaging 1.00
R8199:Hoxa5 UTSW 6 52204260 missense probably benign 0.01
R8947:Hoxa5 UTSW 6 52202796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGAGAACAGGGCTTCTTC -3'
(R):5'- AGGAGTTGGTGGCTAAACCG -3'

Sequencing Primer
(F):5'- GGAGTTTCAGAAAGTCACCTTAGTAC -3'
(R):5'- ATATAGGTGGCCCAGAAG -3'
Posted On 2014-10-30