Mutagenetix > Incidental Mutations

Incidental Mutation 'R2332:Hoxa5'

246468

Institutional Source

Beutler Lab

Gene Symbol

Hoxa5

Ensembl Gene

ENSMUSG00000038253

Gene Name

homeobox A5

Synonyms

Hox-1.3

MMRRC Submission

040322-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.715) question?

Stock #

R2332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52201754-52204587 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52202679 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 239 (I239V)

Ref Sequence

ENSEMBL: ENSMUSP00000039012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048794] [ENSMUST00000062829] [ENSMUST00000114434] [ENSMUST00000128102]

AlphaFold

P09021

Predicted Effect

probably damaging
Transcript: ENSMUST00000048794
AA Change: I239V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039012
Gene: ENSMUSG00000038253
AA Change: I239V

Domain	Start	End	E-Value	Type
low complexity region	65	86	N/A	INTRINSIC
low complexity region	117	134	N/A	INTRINSIC
low complexity region	146	175	N/A	INTRINSIC
HOX	195	257	1.63e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000062829

SMART Domains

Protein: ENSMUSP00000058755
Gene: ENSMUSG00000043219

Domain	Start	End	E-Value	Type
HOX	154	216	2.43e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114434

SMART Domains

Protein: ENSMUSP00000110077
Gene: ENSMUSG00000079560

Domain	Start	End	E-Value	Type
low complexity region	76	131	N/A	INTRINSIC
HOX	192	254	3.35e-28	SMART
low complexity region	287	302	N/A	INTRINSIC
low complexity region	304	326	N/A	INTRINSIC
Pfam:DUF4074	377	441	9e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128102

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136806

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142764

Meta Mutation Damage Score

0.1069

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Methylation of this gene may result in the loss of its expression and, since the encoded protein upregulates the tumor suppressor p53, this protein may play an important role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show skeletal defects, tracheal and lung dysmorphology, reduced surfactant production, emphysema, and partial neonatal lethality. Survivors show stunted growth, delayed ear elevation and eyelid opening, and altered thyroid development, digestive secretion, and ovarian biology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	C	18: 34,317,059	I2302T	possibly damaging	Het
Apoa4	G	A	9: 46,242,355	V85I	probably benign	Het
Banf1	C	T	19: 5,365,030	W84*	probably null	Het
Cdk13	A	G	13: 17,718,695	L627P	probably damaging	Het
Cep250	A	G	2: 155,990,607	E1483G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ddx60	A	G	8: 62,037,091	E1698G	probably benign	Het
Depdc1a	C	A	3: 159,523,866	Q612K	probably damaging	Het
Dnaja2	G	A	8: 85,540,136	R321C	probably damaging	Het
Fam186b	T	A	15: 99,280,428	E339V	probably benign	Het
Fga	T	C	3: 83,031,397	F360L	probably damaging	Het
Fut9	C	T	4: 25,619,823	W330*	probably null	Het
Ghr	T	C	15: 3,320,409	N429S	probably benign	Het
Gm5444	A	T	13: 4,833,625		noncoding transcript	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hps6	T	C	19: 46,004,491	V289A	possibly damaging	Het
Iqcb1	A	G	16: 36,843,439	N190D	possibly damaging	Het
Map3k13	G	A	16: 21,898,677		probably null	Het
Olfr1115	T	C	2: 87,252,873	V312A	possibly damaging	Het
Olfr607	A	G	7: 103,461,086	Y41H	probably damaging	Het
Pacsin1	A	G	17: 27,704,911	E93G	possibly damaging	Het
Pds5a	A	G	5: 65,627,079		probably null	Het
Ppp1r9b	A	T	11: 94,996,609	E482D	probably damaging	Het
Rhobtb3	A	G	13: 75,910,852	S276P	probably benign	Het
Rimbp2	A	G	5: 128,789,641	V538A	probably benign	Het
Rmdn3	A	T	2: 119,153,527		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Slc4a11	A	T	2: 130,684,459	V855D	probably benign	Het
Speer4f1	C	A	5: 17,479,524	N183K	probably damaging	Het
Sstr4	A	T	2: 148,396,410	N314Y	probably damaging	Het
Synj2	A	G	17: 6,023,794	K288E	probably damaging	Het
Trhde	T	A	10: 114,592,165	N409Y	probably damaging	Het
Ttn	A	T	2: 76,781,139	W15604R	probably damaging	Het
Ugdh	C	T	5: 65,427,484	V32I	possibly damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vps13d	G	T	4: 145,148,686	D1750E	probably benign	Het
Wdfy3	A	G	5: 101,888,323		probably benign	Het
Wnt4	C	A	4: 137,296,520	T266K	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp322a	A	T	13: 23,357,324	C83S	probably damaging	Het

Other mutations in Hoxa5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Hoxa5	APN	6	52204331	missense	probably damaging	1.00
IGL01885:Hoxa5	APN	6	52202667	missense	probably damaging	1.00
IGL02021:Hoxa5	APN	6	52202657	missense	probably damaging	1.00
IGL02631:Hoxa5	APN	6	52203810	missense	probably damaging	1.00
IGL02885:Hoxa5	APN	6	52202708	missense	probably damaging	1.00
R0377:Hoxa5	UTSW	6	52202646	missense	probably damaging	1.00
R0543:Hoxa5	UTSW	6	52204340	missense	probably damaging	1.00
R1061:Hoxa5	UTSW	6	52204155	missense	probably benign
R1460:Hoxa5	UTSW	6	52203948	missense	probably benign	0.00
R1465:Hoxa5	UTSW	6	52203791	missense	probably benign	0.37
R1465:Hoxa5	UTSW	6	52203791	missense	probably benign	0.37
R1804:Hoxa5	UTSW	6	52202648	missense	probably damaging	1.00
R1822:Hoxa5	UTSW	6	52202732	missense	probably damaging	1.00
R4303:Hoxa5	UTSW	6	52204260	missense	probably benign	0.01
R4796:Hoxa5	UTSW	6	52203963	missense	probably benign	0.01
R5642:Hoxa5	UTSW	6	52204217	missense	probably damaging	1.00
R6212:Hoxa5	UTSW	6	52202714	missense	probably damaging	1.00
R7134:Hoxa5	UTSW	6	52204043	missense	probably damaging	1.00
R7172:Hoxa5	UTSW	6	52204296	missense	probably damaging	1.00
R8037:Hoxa5	UTSW	6	52204329	missense	probably damaging	1.00
R8038:Hoxa5	UTSW	6	52204329	missense	probably damaging	1.00
R8199:Hoxa5	UTSW	6	52204260	missense	probably benign	0.01
R8947:Hoxa5	UTSW	6	52202796	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACGAGAACAGGGCTTCTTC -3'
(R):5'- AGGAGTTGGTGGCTAAACCG -3'

Sequencing Primer
(F):5'- GGAGTTTCAGAAAGTCACCTTAGTAC -3'
(R):5'- ATATAGGTGGCCCAGAAG -3'

Posted On

2014-10-30