Incidental Mutation 'R2332:Olfr607'
ID 246469
Institutional Source Beutler Lab
Gene Symbol Olfr607
Ensembl Gene ENSMUSG00000081945
Gene Name olfactory receptor 607
Synonyms EG546989, GA_x6K02T2PBJ9-6182881-6181898, MOR33-3P
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103455526-103464151 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103461086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 41 (Y41H)
Ref Sequence ENSEMBL: ENSMUSP00000154348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119283] [ENSMUST00000214347]
AlphaFold A0A2I3BR67
Predicted Effect probably damaging
Transcript: ENSMUST00000045546
AA Change: Y36H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041119
Gene: ENSMUSG00000042402
AA Change: Y36H

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:7tm_4 32 305 9.9e-102 PFAM
Pfam:7TM_GPCR_Srsx 36 304 3.7e-8 PFAM
Pfam:7tm_1 42 293 5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119283
AA Change: Y36H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214347
AA Change: Y41H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.5229 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Olfr607
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Olfr607 APN 7 103461014 missense possibly damaging 0.90
R0919:Olfr607 UTSW 7 103460812 missense probably damaging 1.00
R2105:Olfr607 UTSW 7 103460273 splice site probably null
R4656:Olfr607 UTSW 7 103460488 missense probably benign 0.05
R4859:Olfr607 UTSW 7 103461036 nonsense probably null
R5260:Olfr607 UTSW 7 103460615 missense probably benign 0.03
R5277:Olfr607 UTSW 7 103460941 missense probably damaging 0.96
R5572:Olfr607 UTSW 7 103460698 missense probably benign 0.02
R5593:Olfr607 UTSW 7 103460385 synonymous silent
R5788:Olfr607 UTSW 7 103460879 missense possibly damaging 0.49
R9083:Olfr607 UTSW 7 103460689 missense
Z1177:Olfr607 UTSW 7 103460466 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGGAATGTGGCTTCCAAG -3'
(R):5'- GAGCATTCCATCCACTAGCC -3'

Sequencing Primer
(F):5'- ATGTGGCTTCCAAGGGGCC -3'
(R):5'- GGGACTTCACTAGCATTAAAACATTG -3'
Posted On 2014-10-30