Mutagenetix > Incidental Mutations

Incidental Mutation 'R2332:Sh3rf1'

246471

Institutional Source

Beutler Lab

Gene Symbol

Sh3rf1

Ensembl Gene

ENSMUSG00000031642

Gene Name

SH3 domain containing ring finger 1

Synonyms

Sh3md2, Posh, 2200003J05Rik

MMRRC Submission

040322-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.364) question?

Stock #

R2332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61223872-61396071 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 61226287 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 121 (P121L)

Ref Sequence

ENSEMBL: ENSMUSP00000148118 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034060] [ENSMUST00000209611]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034060
AA Change: P121L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000034060
Gene: ENSMUSG00000031642
AA Change: P121L

Domain	Start	End	E-Value	Type
RING	12	52	5.3e-9	SMART
low complexity region	83	90	N/A	INTRINSIC
SH3	137	192	1.67e-18	SMART
SH3	199	258	4.84e-15	SMART
low complexity region	366	376	N/A	INTRINSIC
low complexity region	397	405	N/A	INTRINSIC
low complexity region	417	430	N/A	INTRINSIC
SH3	454	511	7.92e-20	SMART
low complexity region	558	569	N/A	INTRINSIC
low complexity region	638	651	N/A	INTRINSIC
low complexity region	700	734	N/A	INTRINSIC
SH3	835	891	1.47e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000209611
AA Change: P121L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Meta Mutation Damage Score

0.0598

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an N-terminus RING-finger, four SH3 domains, and a region implicated in binding of the Rho GTPase Rac. Via the RING-finger, the encoded protein has been shown to function as an ubiquitin-protein ligase involved in protein sorting at the trans-Golgi network. The encoded protein may also act as a scaffold for the c-Jun N-terminal kinase signaling pathway, facilitating the formation of a functional signaling module. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	C	18: 34,317,059	I2302T	possibly damaging	Het
Apoa4	G	A	9: 46,242,355	V85I	probably benign	Het
Banf1	C	T	19: 5,365,030	W84*	probably null	Het
Cdk13	A	G	13: 17,718,695	L627P	probably damaging	Het
Cep250	A	G	2: 155,990,607	E1483G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ddx60	A	G	8: 62,037,091	E1698G	probably benign	Het
Depdc1a	C	A	3: 159,523,866	Q612K	probably damaging	Het
Dnaja2	G	A	8: 85,540,136	R321C	probably damaging	Het
Fam186b	T	A	15: 99,280,428	E339V	probably benign	Het
Fga	T	C	3: 83,031,397	F360L	probably damaging	Het
Fut9	C	T	4: 25,619,823	W330*	probably null	Het
Ghr	T	C	15: 3,320,409	N429S	probably benign	Het
Gm5444	A	T	13: 4,833,625		noncoding transcript	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hoxa5	T	C	6: 52,202,679	I239V	probably damaging	Het
Hps6	T	C	19: 46,004,491	V289A	possibly damaging	Het
Iqcb1	A	G	16: 36,843,439	N190D	possibly damaging	Het
Map3k13	G	A	16: 21,898,677		probably null	Het
Olfr1115	T	C	2: 87,252,873	V312A	possibly damaging	Het
Olfr607	A	G	7: 103,461,086	Y41H	probably damaging	Het
Pacsin1	A	G	17: 27,704,911	E93G	possibly damaging	Het
Pds5a	A	G	5: 65,627,079		probably null	Het
Ppp1r9b	A	T	11: 94,996,609	E482D	probably damaging	Het
Rhobtb3	A	G	13: 75,910,852	S276P	probably benign	Het
Rimbp2	A	G	5: 128,789,641	V538A	probably benign	Het
Rmdn3	A	T	2: 119,153,527		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc4a11	A	T	2: 130,684,459	V855D	probably benign	Het
Speer4f1	C	A	5: 17,479,524	N183K	probably damaging	Het
Sstr4	A	T	2: 148,396,410	N314Y	probably damaging	Het
Synj2	A	G	17: 6,023,794	K288E	probably damaging	Het
Trhde	T	A	10: 114,592,165	N409Y	probably damaging	Het
Ttn	A	T	2: 76,781,139	W15604R	probably damaging	Het
Ugdh	C	T	5: 65,427,484	V32I	possibly damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vps13d	G	T	4: 145,148,686	D1750E	probably benign	Het
Wdfy3	A	G	5: 101,888,323		probably benign	Het
Wnt4	C	A	4: 137,296,520	T266K	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp322a	A	T	13: 23,357,324	C83S	probably damaging	Het

Other mutations in Sh3rf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Sh3rf1	APN	8	61329336	missense	probably damaging	1.00
IGL01071:Sh3rf1	APN	8	61225959	missense	probably damaging	1.00
IGL01485:Sh3rf1	APN	8	61329331	missense	possibly damaging	0.79
IGL01587:Sh3rf1	APN	8	61226058	missense	probably damaging	0.99
IGL02412:Sh3rf1	APN	8	61372689	missense	probably benign	0.35
IGL02649:Sh3rf1	APN	8	61363191	missense	probably damaging	1.00
limpid	UTSW	8	61329258	missense	probably damaging	1.00
IGL02835:Sh3rf1	UTSW	8	61226047	missense	probably damaging	1.00
R0009:Sh3rf1	UTSW	8	61226293	missense	probably damaging	0.97
R0016:Sh3rf1	UTSW	8	61374138	missense	probably benign	0.18
R0040:Sh3rf1	UTSW	8	61329252	missense	possibly damaging	0.96
R0040:Sh3rf1	UTSW	8	61329252	missense	possibly damaging	0.96
R0278:Sh3rf1	UTSW	8	61374018	missense	probably damaging	1.00
R0395:Sh3rf1	UTSW	8	61393662	splice site	probably benign
R0733:Sh3rf1	UTSW	8	61372560	missense	probably benign	0.00
R0790:Sh3rf1	UTSW	8	61329258	missense	probably damaging	1.00
R1028:Sh3rf1	UTSW	8	61393787	missense	possibly damaging	0.94
R1569:Sh3rf1	UTSW	8	61384862	missense	probably damaging	1.00
R1654:Sh3rf1	UTSW	8	61361745	missense	possibly damaging	0.92
R1799:Sh3rf1	UTSW	8	61372627	missense	probably damaging	0.99
R1960:Sh3rf1	UTSW	8	61384863	missense	probably damaging	1.00
R2181:Sh3rf1	UTSW	8	61363238	missense	probably damaging	0.98
R2184:Sh3rf1	UTSW	8	61372654	missense	probably damaging	0.99
R2330:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R2331:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R2967:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R2994:Sh3rf1	UTSW	8	61372575	missense	probably benign	0.10
R3159:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R3195:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R3196:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R3724:Sh3rf1	UTSW	8	61372722	missense	probably benign
R4692:Sh3rf1	UTSW	8	61353854	splice site	probably null
R4712:Sh3rf1	UTSW	8	61361759	missense	probably benign	0.00
R5214:Sh3rf1	UTSW	8	61372731	missense	probably damaging	0.98
R5409:Sh3rf1	UTSW	8	61374245	missense	probably benign	0.01
R5590:Sh3rf1	UTSW	8	61361732	missense	probably benign	0.11
R5651:Sh3rf1	UTSW	8	61363167	missense	probably damaging	1.00
R6976:Sh3rf1	UTSW	8	61361732	nonsense	probably null
R7126:Sh3rf1	UTSW	8	61349424	missense	probably benign	0.01
R7154:Sh3rf1	UTSW	8	61372714	missense	possibly damaging	0.89
R7625:Sh3rf1	UTSW	8	61372722	missense	probably benign
R7747:Sh3rf1	UTSW	8	61353753	missense	probably damaging	0.97
R8217:Sh3rf1	UTSW	8	61329930	missense	possibly damaging	0.95
R8705:Sh3rf1	UTSW	8	61349557	missense	probably damaging	1.00
R8711:Sh3rf1	UTSW	8	61329996	missense	probably damaging	1.00
R8735:Sh3rf1	UTSW	8	61372653	missense	probably benign	0.30
R8969:Sh3rf1	UTSW	8	61384826	missense	probably benign	0.17
R9015:Sh3rf1	UTSW	8	61374168	missense	probably benign	0.00
R9085:Sh3rf1	UTSW	8	61349459	missense	probably benign	0.00
R9089:Sh3rf1	UTSW	8	61372579	missense	probably benign	0.01
R9188:Sh3rf1	UTSW	8	61361773	critical splice donor site	probably null
R9259:Sh3rf1	UTSW	8	61353804	missense	probably benign	0.05
X0066:Sh3rf1	UTSW	8	61226197	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGAATGCCGGACTCTTGTTG -3'
(R):5'- TCGGATCCAGTCTTATTTCAAGAG -3'

Sequencing Primer
(F):5'- GTCGACGAGCTCCCCAGTAAC -3'
(R):5'- AGAAAATAAGGTCCTAAGGTTGAATC -3'

Posted On

2014-10-30