Incidental Mutation 'R2332:Sh3rf1'
ID 246471
Institutional Source Beutler Lab
Gene Symbol Sh3rf1
Ensembl Gene ENSMUSG00000031642
Gene Name SH3 domain containing ring finger 1
Synonyms Sh3md2, Posh, 2200003J05Rik
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 61223872-61396071 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 61226287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 121 (P121L)
Ref Sequence ENSEMBL: ENSMUSP00000148118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034060] [ENSMUST00000209611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034060
AA Change: P121L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034060
Gene: ENSMUSG00000031642
AA Change: P121L

DomainStartEndE-ValueType
RING 12 52 5.3e-9 SMART
low complexity region 83 90 N/A INTRINSIC
SH3 137 192 1.67e-18 SMART
SH3 199 258 4.84e-15 SMART
low complexity region 366 376 N/A INTRINSIC
low complexity region 397 405 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
SH3 454 511 7.92e-20 SMART
low complexity region 558 569 N/A INTRINSIC
low complexity region 638 651 N/A INTRINSIC
low complexity region 700 734 N/A INTRINSIC
SH3 835 891 1.47e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209611
AA Change: P121L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an N-terminus RING-finger, four SH3 domains, and a region implicated in binding of the Rho GTPase Rac. Via the RING-finger, the encoded protein has been shown to function as an ubiquitin-protein ligase involved in protein sorting at the trans-Golgi network. The encoded protein may also act as a scaffold for the c-Jun N-terminal kinase signaling pathway, facilitating the formation of a functional signaling module. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Sh3rf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Sh3rf1 APN 8 61329336 missense probably damaging 1.00
IGL01071:Sh3rf1 APN 8 61225959 missense probably damaging 1.00
IGL01485:Sh3rf1 APN 8 61329331 missense possibly damaging 0.79
IGL01587:Sh3rf1 APN 8 61226058 missense probably damaging 0.99
IGL02412:Sh3rf1 APN 8 61372689 missense probably benign 0.35
IGL02649:Sh3rf1 APN 8 61363191 missense probably damaging 1.00
limpid UTSW 8 61329258 missense probably damaging 1.00
IGL02835:Sh3rf1 UTSW 8 61226047 missense probably damaging 1.00
R0009:Sh3rf1 UTSW 8 61226293 missense probably damaging 0.97
R0016:Sh3rf1 UTSW 8 61374138 missense probably benign 0.18
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0278:Sh3rf1 UTSW 8 61374018 missense probably damaging 1.00
R0395:Sh3rf1 UTSW 8 61393662 splice site probably benign
R0733:Sh3rf1 UTSW 8 61372560 missense probably benign 0.00
R0790:Sh3rf1 UTSW 8 61329258 missense probably damaging 1.00
R1028:Sh3rf1 UTSW 8 61393787 missense possibly damaging 0.94
R1569:Sh3rf1 UTSW 8 61384862 missense probably damaging 1.00
R1654:Sh3rf1 UTSW 8 61361745 missense possibly damaging 0.92
R1799:Sh3rf1 UTSW 8 61372627 missense probably damaging 0.99
R1960:Sh3rf1 UTSW 8 61384863 missense probably damaging 1.00
R2181:Sh3rf1 UTSW 8 61363238 missense probably damaging 0.98
R2184:Sh3rf1 UTSW 8 61372654 missense probably damaging 0.99
R2330:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2331:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2967:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2994:Sh3rf1 UTSW 8 61372575 missense probably benign 0.10
R3159:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3195:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3196:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3724:Sh3rf1 UTSW 8 61372722 missense probably benign
R4692:Sh3rf1 UTSW 8 61353854 splice site probably null
R4712:Sh3rf1 UTSW 8 61361759 missense probably benign 0.00
R5214:Sh3rf1 UTSW 8 61372731 missense probably damaging 0.98
R5409:Sh3rf1 UTSW 8 61374245 missense probably benign 0.01
R5590:Sh3rf1 UTSW 8 61361732 missense probably benign 0.11
R5651:Sh3rf1 UTSW 8 61363167 missense probably damaging 1.00
R6976:Sh3rf1 UTSW 8 61361732 nonsense probably null
R7126:Sh3rf1 UTSW 8 61349424 missense probably benign 0.01
R7154:Sh3rf1 UTSW 8 61372714 missense possibly damaging 0.89
R7625:Sh3rf1 UTSW 8 61372722 missense probably benign
R7747:Sh3rf1 UTSW 8 61353753 missense probably damaging 0.97
R8217:Sh3rf1 UTSW 8 61329930 missense possibly damaging 0.95
R8705:Sh3rf1 UTSW 8 61349557 missense probably damaging 1.00
R8711:Sh3rf1 UTSW 8 61329996 missense probably damaging 1.00
R8735:Sh3rf1 UTSW 8 61372653 missense probably benign 0.30
R8969:Sh3rf1 UTSW 8 61384826 missense probably benign 0.17
R9015:Sh3rf1 UTSW 8 61374168 missense probably benign 0.00
R9085:Sh3rf1 UTSW 8 61349459 missense probably benign 0.00
R9089:Sh3rf1 UTSW 8 61372579 missense probably benign 0.01
R9188:Sh3rf1 UTSW 8 61361773 critical splice donor site probably null
R9259:Sh3rf1 UTSW 8 61353804 missense probably benign 0.05
X0066:Sh3rf1 UTSW 8 61226197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAATGCCGGACTCTTGTTG -3'
(R):5'- TCGGATCCAGTCTTATTTCAAGAG -3'

Sequencing Primer
(F):5'- GTCGACGAGCTCCCCAGTAAC -3'
(R):5'- AGAAAATAAGGTCCTAAGGTTGAATC -3'
Posted On 2014-10-30