Mutagenetix > Incidental Mutations

Incidental Mutation 'R2332:Ddx60'

246472

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

040322-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R2332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62037091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1698 (E1698G)

Ref Sequence

ENSEMBL: ENSMUSP00000091197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]

AlphaFold

E9PZQ1

Predicted Effect

probably benign
Transcript: ENSMUST00000070631
AA Change: E1697G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: E1697G

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000093485
AA Change: E1698G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: E1698G

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136121

Meta Mutation Damage Score

0.0868

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (47/48)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	C	18: 34,317,059	I2302T	possibly damaging	Het
Apoa4	G	A	9: 46,242,355	V85I	probably benign	Het
Banf1	C	T	19: 5,365,030	W84*	probably null	Het
Cdk13	A	G	13: 17,718,695	L627P	probably damaging	Het
Cep250	A	G	2: 155,990,607	E1483G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Depdc1a	C	A	3: 159,523,866	Q612K	probably damaging	Het
Dnaja2	G	A	8: 85,540,136	R321C	probably damaging	Het
Fam186b	T	A	15: 99,280,428	E339V	probably benign	Het
Fga	T	C	3: 83,031,397	F360L	probably damaging	Het
Fut9	C	T	4: 25,619,823	W330*	probably null	Het
Ghr	T	C	15: 3,320,409	N429S	probably benign	Het
Gm5444	A	T	13: 4,833,625		noncoding transcript	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hoxa5	T	C	6: 52,202,679	I239V	probably damaging	Het
Hps6	T	C	19: 46,004,491	V289A	possibly damaging	Het
Iqcb1	A	G	16: 36,843,439	N190D	possibly damaging	Het
Map3k13	G	A	16: 21,898,677		probably null	Het
Olfr1115	T	C	2: 87,252,873	V312A	possibly damaging	Het
Olfr607	A	G	7: 103,461,086	Y41H	probably damaging	Het
Pacsin1	A	G	17: 27,704,911	E93G	possibly damaging	Het
Pds5a	A	G	5: 65,627,079		probably null	Het
Ppp1r9b	A	T	11: 94,996,609	E482D	probably damaging	Het
Rhobtb3	A	G	13: 75,910,852	S276P	probably benign	Het
Rimbp2	A	G	5: 128,789,641	V538A	probably benign	Het
Rmdn3	A	T	2: 119,153,527		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Slc4a11	A	T	2: 130,684,459	V855D	probably benign	Het
Speer4f1	C	A	5: 17,479,524	N183K	probably damaging	Het
Sstr4	A	T	2: 148,396,410	N314Y	probably damaging	Het
Synj2	A	G	17: 6,023,794	K288E	probably damaging	Het
Trhde	T	A	10: 114,592,165	N409Y	probably damaging	Het
Ttn	A	T	2: 76,781,139	W15604R	probably damaging	Het
Ugdh	C	T	5: 65,427,484	V32I	possibly damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vps13d	G	T	4: 145,148,686	D1750E	probably benign	Het
Wdfy3	A	G	5: 101,888,323		probably benign	Het
Wnt4	C	A	4: 137,296,520	T266K	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp322a	A	T	13: 23,357,324	C83S	probably damaging	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8884:Ddx60	UTSW	8	61994519	missense	possibly damaging	0.86
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TCACCCTTTGCTGAATGTGAC -3'
(R):5'- ACAAGAAGTTTGATGGCAACTC -3'

Sequencing Primer
(F):5'- CTTTAGAGGACAGCCCTTT -3'
(R):5'- AGAAGTTTGATGGCAACTCTATTTG -3'

Posted On

2014-10-30