Incidental Mutation 'R2332:Dnaja2'
ID 246473
Institutional Source Beutler Lab
Gene Symbol Dnaja2
Ensembl Gene ENSMUSG00000031701
Gene Name DnaJ heat shock protein family (Hsp40) member A2
Synonyms 2010206B19Rik, mDj3, HIRIP4, 1500017M13Rik, PRO3015, DNJ3
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 85537633-85555344 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 85540136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 321 (R321C)
Ref Sequence ENSEMBL: ENSMUSP00000034138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034138]
AlphaFold Q9QYJ0
Predicted Effect probably damaging
Transcript: ENSMUST00000034138
AA Change: R321C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034138
Gene: ENSMUSG00000031701
AA Change: R321C

DomainStartEndE-ValueType
DnaJ 7 62 8.53e-31 SMART
low complexity region 70 83 N/A INTRINSIC
low complexity region 101 113 N/A INTRINSIC
Pfam:DnaJ_C 116 338 8.5e-36 PFAM
Pfam:DnaJ_CXXCXGXG 143 209 3.4e-18 PFAM
low complexity region 393 403 N/A INTRINSIC
Meta Mutation Damage Score 0.5261 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain. The product of this gene works as a cochaperone of Hsp70s in protein folding and mitochondrial protein import in vitro. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Dnaja2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Dnaja2 APN 8 85555237 missense probably damaging 0.98
IGL01479:Dnaja2 APN 8 85553951 missense probably damaging 1.00
IGL01722:Dnaja2 APN 8 85553279 missense probably benign 0.35
IGL01946:Dnaja2 APN 8 85546700 missense probably damaging 1.00
IGL03310:Dnaja2 APN 8 85548905 missense probably benign 0.00
R0689:Dnaja2 UTSW 8 85546718 splice site probably benign
R1350:Dnaja2 UTSW 8 85540088 missense probably damaging 1.00
R3105:Dnaja2 UTSW 8 85555228 missense probably damaging 1.00
R3693:Dnaja2 UTSW 8 85546620 missense probably damaging 0.99
R3787:Dnaja2 UTSW 8 85540386 missense probably damaging 1.00
R4803:Dnaja2 UTSW 8 85553400 missense probably damaging 1.00
R5109:Dnaja2 UTSW 8 85553258 missense possibly damaging 0.51
R5428:Dnaja2 UTSW 8 85540175 missense probably benign
R5576:Dnaja2 UTSW 8 85539404 missense possibly damaging 0.95
R7055:Dnaja2 UTSW 8 85548674 missense probably benign 0.00
R7385:Dnaja2 UTSW 8 85539353 missense probably benign
R7662:Dnaja2 UTSW 8 85539276 missense probably benign 0.17
R7693:Dnaja2 UTSW 8 85540310 missense probably damaging 1.00
R8049:Dnaja2 UTSW 8 85539247 missense possibly damaging 0.63
Z1177:Dnaja2 UTSW 8 85540071 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCACCATAGAGACTCTGTC -3'
(R):5'- GGTAAATGATTTCTTCTTACCCAGG -3'

Sequencing Primer
(F):5'- CATAACTGTGAGTTCTAGGCCAGC -3'
(R):5'- AATGATTTCTTCTTACCCAGGTTCTG -3'
Posted On 2014-10-30