Mutagenetix > Incidental Mutations

Incidental Mutation 'R2332:Apoa4'

246474

Institutional Source

Beutler Lab

Gene Symbol

Apoa4

Ensembl Gene

ENSMUSG00000032080

Gene Name

apolipoprotein A-IV

Synonyms

Apoa-4

MMRRC Submission

040322-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R2332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46240696-46243459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 46242355 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 85 (V85I)

Ref Sequence

ENSEMBL: ENSMUSP00000034585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034585]

Predicted Effect

probably benign
Transcript: ENSMUST00000034585
AA Change: V85I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000034585
Gene: ENSMUSG00000032080
AA Change: V85I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Apolipoprotein	61	213	1.1e-33	PFAM
Pfam:Apolipoprotein	182	338	9.1e-29	PFAM
Pfam:Apolipoprotein	298	390	7.4e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156612

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215445

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoliprotein (apo) A-IV gene contains 3 exons separated by two introns. A sequence polymorphism has been identified in the 3'UTR of the third exon. The primary translation product is a 396-residue preprotein which after proteolytic processing is secreted its primary site of synthesis, the intestine, in association with chylomicron particles. Although its precise function is not known, apo A-IV is a potent activator of lecithin-cholesterol acyltransferase in vitro. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene have lower HDL cholesterol levels but normal lipid absorption, growth, and feeding behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	C	18: 34,317,059	I2302T	possibly damaging	Het
Banf1	C	T	19: 5,365,030	W84*	probably null	Het
Cdk13	A	G	13: 17,718,695	L627P	probably damaging	Het
Cep250	A	G	2: 155,990,607	E1483G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ddx60	A	G	8: 62,037,091	E1698G	probably benign	Het
Depdc1a	C	A	3: 159,523,866	Q612K	probably damaging	Het
Dnaja2	G	A	8: 85,540,136	R321C	probably damaging	Het
Fam186b	T	A	15: 99,280,428	E339V	probably benign	Het
Fga	T	C	3: 83,031,397	F360L	probably damaging	Het
Fut9	C	T	4: 25,619,823	W330*	probably null	Het
Ghr	T	C	15: 3,320,409	N429S	probably benign	Het
Gm5444	A	T	13: 4,833,625		noncoding transcript	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hoxa5	T	C	6: 52,202,679	I239V	probably damaging	Het
Hps6	T	C	19: 46,004,491	V289A	possibly damaging	Het
Iqcb1	A	G	16: 36,843,439	N190D	possibly damaging	Het
Map3k13	G	A	16: 21,898,677		probably null	Het
Olfr1115	T	C	2: 87,252,873	V312A	possibly damaging	Het
Olfr607	A	G	7: 103,461,086	Y41H	probably damaging	Het
Pacsin1	A	G	17: 27,704,911	E93G	possibly damaging	Het
Pds5a	A	G	5: 65,627,079		probably null	Het
Ppp1r9b	A	T	11: 94,996,609	E482D	probably damaging	Het
Rhobtb3	A	G	13: 75,910,852	S276P	probably benign	Het
Rimbp2	A	G	5: 128,789,641	V538A	probably benign	Het
Rmdn3	A	T	2: 119,153,527		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Slc4a11	A	T	2: 130,684,459	V855D	probably benign	Het
Speer4f1	C	A	5: 17,479,524	N183K	probably damaging	Het
Sstr4	A	T	2: 148,396,410	N314Y	probably damaging	Het
Synj2	A	G	17: 6,023,794	K288E	probably damaging	Het
Trhde	T	A	10: 114,592,165	N409Y	probably damaging	Het
Ttn	A	T	2: 76,781,139	W15604R	probably damaging	Het
Ugdh	C	T	5: 65,427,484	V32I	possibly damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vps13d	G	T	4: 145,148,686	D1750E	probably benign	Het
Wdfy3	A	G	5: 101,888,323		probably benign	Het
Wnt4	C	A	4: 137,296,520	T266K	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp322a	A	T	13: 23,357,324	C83S	probably damaging	Het

Other mutations in Apoa4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01574:Apoa4	APN	9	46242985	missense	probably benign	0.30
IGL02321:Apoa4	APN	9	46242920	missense	probably damaging	0.98
R0001:Apoa4	UTSW	9	46242892	missense	probably benign	0.03
R0054:Apoa4	UTSW	9	46242524	missense	probably benign	0.00
R0054:Apoa4	UTSW	9	46242524	missense	probably benign	0.00
R0401:Apoa4	UTSW	9	46243058	missense	probably damaging	1.00
R1446:Apoa4	UTSW	9	46242293	missense	probably benign	0.03
R2027:Apoa4	UTSW	9	46243000	missense	probably damaging	1.00
R4979:Apoa4	UTSW	9	46241505	missense	probably benign	0.01
R5120:Apoa4	UTSW	9	46242737	missense	probably damaging	1.00
R5780:Apoa4	UTSW	9	46242592	missense	possibly damaging	0.77
R6769:Apoa4	UTSW	9	46243167	missense	probably benign	0.01
R6771:Apoa4	UTSW	9	46243167	missense	probably benign	0.01
R7009:Apoa4	UTSW	9	46242880	missense	possibly damaging	0.82
R7384:Apoa4	UTSW	9	46241474	missense	not run
R7625:Apoa4	UTSW	9	46243112	missense	probably damaging	0.99
R8039:Apoa4	UTSW	9	46242293	missense	possibly damaging	0.70
Z1176:Apoa4	UTSW	9	46242589	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TGGACACACTCCTGACCTAAGC -3'
(R):5'- CTGCATGCGCTGGATGTATG -3'

Sequencing Primer
(F):5'- CCTAAGCAGGTGTATAGAGCTG -3'
(R):5'- GATCTGATCTTGCAGGTCCACG -3'

Posted On

2014-10-30