Mutagenetix > Incidental Mutations

Incidental Mutation 'R2332:Trhde'

246475

Institutional Source

Beutler Lab

Gene Symbol

Trhde

Ensembl Gene

ENSMUSG00000050663

Gene Name

TRH-degrading enzyme

Synonyms

MMRRC Submission

040322-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R2332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114398823-114802307 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 114592165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 409 (N409Y)

Ref Sequence

ENSEMBL: ENSMUSP00000057449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061632]

AlphaFold

Q8K093

Predicted Effect

probably damaging
Transcript: ENSMUST00000061632
AA Change: N409Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057449
Gene: ENSMUSG00000050663
AA Change: N409Y

Domain	Start	End	E-Value	Type
transmembrane domain	40	62	N/A	INTRINSIC
Pfam:Peptidase_M1	141	531	2.6e-141	PFAM
Pfam:ERAP1_C	679	1004	5.7e-65	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152702

Meta Mutation Damage Score

0.8698

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	C	18: 34,317,059	I2302T	possibly damaging	Het
Apoa4	G	A	9: 46,242,355	V85I	probably benign	Het
Banf1	C	T	19: 5,365,030	W84*	probably null	Het
Cdk13	A	G	13: 17,718,695	L627P	probably damaging	Het
Cep250	A	G	2: 155,990,607	E1483G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ddx60	A	G	8: 62,037,091	E1698G	probably benign	Het
Depdc1a	C	A	3: 159,523,866	Q612K	probably damaging	Het
Dnaja2	G	A	8: 85,540,136	R321C	probably damaging	Het
Fam186b	T	A	15: 99,280,428	E339V	probably benign	Het
Fga	T	C	3: 83,031,397	F360L	probably damaging	Het
Fut9	C	T	4: 25,619,823	W330*	probably null	Het
Ghr	T	C	15: 3,320,409	N429S	probably benign	Het
Gm5444	A	T	13: 4,833,625		noncoding transcript	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hoxa5	T	C	6: 52,202,679	I239V	probably damaging	Het
Hps6	T	C	19: 46,004,491	V289A	possibly damaging	Het
Iqcb1	A	G	16: 36,843,439	N190D	possibly damaging	Het
Map3k13	G	A	16: 21,898,677		probably null	Het
Olfr1115	T	C	2: 87,252,873	V312A	possibly damaging	Het
Olfr607	A	G	7: 103,461,086	Y41H	probably damaging	Het
Pacsin1	A	G	17: 27,704,911	E93G	possibly damaging	Het
Pds5a	A	G	5: 65,627,079		probably null	Het
Ppp1r9b	A	T	11: 94,996,609	E482D	probably damaging	Het
Rhobtb3	A	G	13: 75,910,852	S276P	probably benign	Het
Rimbp2	A	G	5: 128,789,641	V538A	probably benign	Het
Rmdn3	A	T	2: 119,153,527		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Slc4a11	A	T	2: 130,684,459	V855D	probably benign	Het
Speer4f1	C	A	5: 17,479,524	N183K	probably damaging	Het
Sstr4	A	T	2: 148,396,410	N314Y	probably damaging	Het
Synj2	A	G	17: 6,023,794	K288E	probably damaging	Het
Ttn	A	T	2: 76,781,139	W15604R	probably damaging	Het
Ugdh	C	T	5: 65,427,484	V32I	possibly damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vps13d	G	T	4: 145,148,686	D1750E	probably benign	Het
Wdfy3	A	G	5: 101,888,323		probably benign	Het
Wnt4	C	A	4: 137,296,520	T266K	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp322a	A	T	13: 23,357,324	C83S	probably damaging	Het

Other mutations in Trhde

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Trhde	APN	10	114486747	missense	possibly damaging	0.77
IGL00516:Trhde	APN	10	114446199	missense	probably benign	0.01
IGL01371:Trhde	APN	10	114588500	missense	possibly damaging	0.57
IGL01488:Trhde	APN	10	114446158	missense	possibly damaging	0.58
IGL01602:Trhde	APN	10	114787943	missense	probably benign
IGL01605:Trhde	APN	10	114787943	missense	probably benign
IGL02150:Trhde	APN	10	114592108	missense	probably damaging	1.00
IGL02165:Trhde	APN	10	114592161	missense	probably damaging	1.00
IGL02340:Trhde	APN	10	114592213	splice site	probably benign
IGL02412:Trhde	APN	10	114486925	missense	probably damaging	1.00
IGL02421:Trhde	APN	10	114412461	missense	probably damaging	1.00
IGL02496:Trhde	APN	10	114800561	nonsense	probably null
IGL02952:Trhde	APN	10	114800573	missense	probably damaging	0.99
IGL03197:Trhde	APN	10	114413308	missense	probably benign	0.00
Cata	UTSW	10	114592066	missense	probably damaging	1.00
l3-37	UTSW	10	114801081	missense	probably benign
Pelte	UTSW	10	114486704	critical splice donor site	probably null
G1Funyon:Trhde	UTSW	10	114487006	missense	probably benign	0.03
R0360:Trhde	UTSW	10	114502982	splice site	probably benign
R0364:Trhde	UTSW	10	114502982	splice site	probably benign
R0457:Trhde	UTSW	10	114448262	missense	probably benign	0.37
R0589:Trhde	UTSW	10	114448324	missense	probably benign	0.01
R1132:Trhde	UTSW	10	114412478	missense	possibly damaging	0.86
R1288:Trhde	UTSW	10	114801290	missense	probably benign	0.37
R1569:Trhde	UTSW	10	114446188	missense	possibly damaging	0.78
R1776:Trhde	UTSW	10	114800603	missense	probably benign	0.06
R1781:Trhde	UTSW	10	114588500	missense	possibly damaging	0.57
R1927:Trhde	UTSW	10	114800849	missense	probably damaging	1.00
R1976:Trhde	UTSW	10	114588431	missense	possibly damaging	0.57
R2011:Trhde	UTSW	10	114498793	missense	probably benign	0.02
R2356:Trhde	UTSW	10	114401516	missense	probably damaging	1.00
R3107:Trhde	UTSW	10	114592066	missense	probably damaging	1.00
R3108:Trhde	UTSW	10	114592066	missense	probably damaging	1.00
R3907:Trhde	UTSW	10	114800696	missense	possibly damaging	0.72
R4067:Trhde	UTSW	10	114444680	nonsense	probably null
R4214:Trhde	UTSW	10	114788070	missense	possibly damaging	0.51
R4428:Trhde	UTSW	10	114503123	missense	probably damaging	1.00
R4429:Trhde	UTSW	10	114503123	missense	probably damaging	1.00
R4430:Trhde	UTSW	10	114503123	missense	probably damaging	1.00
R5244:Trhde	UTSW	10	114801081	missense	probably benign
R5456:Trhde	UTSW	10	114486760	missense	possibly damaging	0.58
R5540:Trhde	UTSW	10	114800592	missense	probably benign	0.45
R5699:Trhde	UTSW	10	114588502	missense	probably benign	0.00
R5967:Trhde	UTSW	10	114567134	missense	probably damaging	1.00
R6326:Trhde	UTSW	10	114567224	missense	probably damaging	1.00
R6467:Trhde	UTSW	10	114504198	missense	probably damaging	1.00
R7028:Trhde	UTSW	10	114518177	missense	probably damaging	1.00
R7264:Trhde	UTSW	10	114800871	missense	possibly damaging	0.93
R7266:Trhde	UTSW	10	114800871	missense	possibly damaging	0.93
R7310:Trhde	UTSW	10	114800573	missense	probably damaging	0.99
R7460:Trhde	UTSW	10	114413263	missense	probably damaging	1.00
R7732:Trhde	UTSW	10	114788064	missense	probably benign
R7842:Trhde	UTSW	10	114696098	missense	possibly damaging	0.86
R8178:Trhde	UTSW	10	114408693	missense	possibly damaging	0.93
R8209:Trhde	UTSW	10	114567228	missense	probably damaging	1.00
R8226:Trhde	UTSW	10	114567228	missense	probably damaging	1.00
R8232:Trhde	UTSW	10	114800537	missense	possibly damaging	0.90
R8301:Trhde	UTSW	10	114487006	missense	probably benign	0.03
R8312:Trhde	UTSW	10	114413287	missense	probably damaging	1.00
R8335:Trhde	UTSW	10	114486704	critical splice donor site	probably null
R8477:Trhde	UTSW	10	114800717	missense	probably benign	0.02
R8853:Trhde	UTSW	10	114800925	missense	probably benign
R8953:Trhde	UTSW	10	114503061	missense	probably damaging	0.98
R9375:Trhde	UTSW	10	114408693	missense	probably damaging	0.99
Z1177:Trhde	UTSW	10	114448389	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTCTGAAGTCACCCCACATTCC -3'
(R):5'- CCAGCATCGATGGAGATAGC -3'

Sequencing Primer
(F):5'- GTCACCCCACATTCCAGACAATTTC -3'
(R):5'- GTCCCATAGACATAGCTGAGTG -3'

Posted On

2014-10-30