Incidental Mutation 'R2332:Ppp1r9b'
ID246476
Institutional Source Beutler Lab
Gene Symbol Ppp1r9b
Ensembl Gene ENSMUSG00000038976
Gene Nameprotein phosphatase 1, regulatory subunit 9B
SynonymsSPL, Spn, spinophilin, neurabin II
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2332 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94991035-95006899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94996609 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 482 (E482D)
Ref Sequence ENSEMBL: ENSMUSP00000041732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038696] [ENSMUST00000107748]
Predicted Effect probably damaging
Transcript: ENSMUST00000038696
AA Change: E482D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041732
Gene: ENSMUSG00000038976
AA Change: E482D

DomainStartEndE-ValueType
low complexity region 64 83 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 253 260 N/A INTRINSIC
low complexity region 281 317 N/A INTRINSIC
low complexity region 332 361 N/A INTRINSIC
low complexity region 399 430 N/A INTRINSIC
Blast:PDZ 431 458 4e-10 BLAST
PDZ 504 584 7.03e-19 SMART
low complexity region 600 612 N/A INTRINSIC
Blast:PDZ 731 768 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107748
AA Change: E58D

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103377
Gene: ENSMUSG00000038976
AA Change: E58D

DomainStartEndE-ValueType
PDZ 80 160 7.03e-19 SMART
low complexity region 176 188 N/A INTRINSIC
Blast:PDZ 307 344 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151771
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions as a regulatory subunit of protein phosphatase 1a. Expression of this gene is particularly high in dendritic spines, suggesting that the encoded protein may play a role in receiving signals from the central nervous system. The encoded protein has putative tumor suppressor function and decreased expression has been observed in tumors. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal glutamatergic synaptic transmission, reduced long-term depression, resistance to kainate-induced seizures, impaired taste aversion learning, and increased dendritic spine density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Ppp1r9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Ppp1r9b APN 11 95005354 missense probably damaging 0.96
IGL02261:Ppp1r9b APN 11 95002110 missense probably damaging 1.00
R0068:Ppp1r9b UTSW 11 95001220 missense probably damaging 1.00
R0719:Ppp1r9b UTSW 11 95001835 splice site probably null
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1385:Ppp1r9b UTSW 11 94992211 missense probably benign 0.06
R1639:Ppp1r9b UTSW 11 94996610 missense probably damaging 1.00
R1642:Ppp1r9b UTSW 11 95001324 synonymous silent
R2000:Ppp1r9b UTSW 11 94996620 missense probably damaging 1.00
R2162:Ppp1r9b UTSW 11 94998051 missense probably damaging 1.00
R3815:Ppp1r9b UTSW 11 94992533 missense probably damaging 1.00
R4426:Ppp1r9b UTSW 11 95001324 missense possibly damaging 0.93
R4427:Ppp1r9b UTSW 11 95001324 missense possibly damaging 0.93
R5121:Ppp1r9b UTSW 11 94996653 missense probably damaging 0.99
R5205:Ppp1r9b UTSW 11 95001298 missense probably benign 0.11
R5348:Ppp1r9b UTSW 11 94996612 nonsense probably null
R5397:Ppp1r9b UTSW 11 95002110 missense probably damaging 1.00
R5399:Ppp1r9b UTSW 11 94992148 missense probably benign
R6188:Ppp1r9b UTSW 11 94991836 missense probably damaging 0.99
R6860:Ppp1r9b UTSW 11 94992148 missense probably benign
R7308:Ppp1r9b UTSW 11 95004571 missense possibly damaging 0.86
R7357:Ppp1r9b UTSW 11 95004598 missense probably benign 0.00
R7479:Ppp1r9b UTSW 11 94992032 missense possibly damaging 0.85
R7587:Ppp1r9b UTSW 11 95001940 missense possibly damaging 0.65
R7651:Ppp1r9b UTSW 11 95001942 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTTGTGAGATCAGTGGAAGGG -3'
(R):5'- GCTATTGATGCGGACAAGGG -3'

Sequencing Primer
(F):5'- AAGGGCCTCTGGGTGGAC -3'
(R):5'- TGCGGACAAGGGATGCC -3'
Posted On2014-10-30