Incidental Mutation 'R2332:Gm5444'
ID 246478
Institutional Source Beutler Lab
Gene Symbol Gm5444
Ensembl Gene ENSMUSG00000053499
Gene Name predicted gene 5444
Synonyms
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 4771649-4836485 bp(+) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) A to T at 4833625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065956
SMART Domains Protein: ENSMUSP00000070493
Gene: ENSMUSG00000053499

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 83 103 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Gm5444
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0716:Gm5444 UTSW 13 4834193 exon noncoding transcript
R2341:Gm5444 UTSW 13 4834345 exon noncoding transcript
R3901:Gm5444 UTSW 13 4834279 exon noncoding transcript
R4520:Gm5444 UTSW 13 4834226 exon noncoding transcript
R5148:Gm5444 UTSW 13 4834315 exon noncoding transcript
R5856:Gm5444 UTSW 13 4771684 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATGGGAATTCATCTCTTCTACTACC -3'
(R):5'- CAGAAGATAAATGCCTGCTTGG -3'

Sequencing Primer
(F):5'- TGTAAAATTCCTAAAGTACCAATGGG -3'
(R):5'- CCTGCTTGGCTCTATAAAAA -3'
Posted On 2014-10-30