Incidental Mutation 'R2332:Zfp322a'
ID 246480
Institutional Source Beutler Lab
Gene Symbol Zfp322a
Ensembl Gene ENSMUSG00000046351
Gene Name zinc finger protein 322A
Synonyms
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 23353103-23369208 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23357324 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 83 (C83S)
Ref Sequence ENSEMBL: ENSMUSP00000118754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050101] [ENSMUST00000125328] [ENSMUST00000145451] [ENSMUST00000152557]
AlphaFold Q8BZ89
Predicted Effect probably damaging
Transcript: ENSMUST00000050101
AA Change: C83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061524
Gene: ENSMUSG00000046351
AA Change: C83S

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
ZnF_C2H2 109 131 3.34e-2 SMART
ZnF_C2H2 137 159 1.28e-3 SMART
ZnF_C2H2 165 187 2.95e-3 SMART
ZnF_C2H2 193 215 1.95e-3 SMART
ZnF_C2H2 221 243 4.79e-3 SMART
ZnF_C2H2 249 271 5.14e-3 SMART
ZnF_C2H2 277 299 8.94e-3 SMART
ZnF_C2H2 303 325 5.68e1 SMART
ZnF_C2H2 361 383 1.89e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122940
Predicted Effect possibly damaging
Transcript: ENSMUST00000125328
AA Change: C83S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120804
Gene: ENSMUSG00000046351
AA Change: C83S

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145451
AA Change: C83S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119883
Gene: ENSMUSG00000046351
AA Change: C83S

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
ZnF_C2H2 109 131 3.34e-2 SMART
ZnF_C2H2 137 159 1.28e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152557
AA Change: C83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118754
Gene: ENSMUSG00000046351
AA Change: C83S

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
ZnF_C2H2 109 131 3.34e-2 SMART
ZnF_C2H2 137 159 1.28e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224779
Meta Mutation Damage Score 0.8689 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZNF322A is a member of the zinc-finger transcription factor family and may regulate transcriptional activation in MAPK (see MAPK1; MIM 176948) signaling pathways (Li et al., 2004 [PubMed 15555580]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Other mutations in Zfp322a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Zfp322a APN 13 23357443 missense probably damaging 0.97
R1395:Zfp322a UTSW 13 23356775 missense probably benign 0.01
R1975:Zfp322a UTSW 13 23356904 missense probably damaging 1.00
R2100:Zfp322a UTSW 13 23357290 missense possibly damaging 0.85
R2571:Zfp322a UTSW 13 23356444 missense probably damaging 1.00
R4959:Zfp322a UTSW 13 23356882 missense probably damaging 1.00
R5245:Zfp322a UTSW 13 23356986 nonsense probably null
R5310:Zfp322a UTSW 13 23357362 missense possibly damaging 0.90
R5389:Zfp322a UTSW 13 23356979 missense probably damaging 1.00
R5525:Zfp322a UTSW 13 23357515 missense probably benign
R5810:Zfp322a UTSW 13 23357409 nonsense probably null
R7299:Zfp322a UTSW 13 23357143 missense probably damaging 0.97
R7299:Zfp322a UTSW 13 23357144 missense probably benign 0.22
R7301:Zfp322a UTSW 13 23357143 missense probably damaging 0.97
R7301:Zfp322a UTSW 13 23357144 missense probably benign 0.22
R8670:Zfp322a UTSW 13 23357104 missense possibly damaging 0.83
R9108:Zfp322a UTSW 13 23357267 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAAGTCACTCTCACACATAGA -3'
(R):5'- GGAAAACATACCATGTATGCCC -3'

Sequencing Primer
(F):5'- ATTCTTGCCACAGATGTCACAGG -3'
(R):5'- TACCATGTATGCCCTCAAAAGG -3'
Posted On 2014-10-30