Incidental Mutation 'R2332:Rhobtb3'
ID 246481
Institutional Source Beutler Lab
Gene Symbol Rhobtb3
Ensembl Gene ENSMUSG00000021589
Gene Name Rho-related BTB domain containing 3
Synonyms 2610033K01Rik, 4930503C18Rik, 1700040C17Rik
MMRRC Submission 040322-MU
Accession Numbers

Ncbi RefSeq: NM_028493.2; MGI:1920546

Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 75869537-75943925 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75910852 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 276 (S276P)
Ref Sequence ENSEMBL: ENSMUSP00000022078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022078] [ENSMUST00000109606]
AlphaFold Q9CTN4
Predicted Effect probably benign
Transcript: ENSMUST00000022078
AA Change: S276P

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022078
Gene: ENSMUSG00000021589
AA Change: S276P

DomainStartEndE-ValueType
Pfam:Ras 47 195 9e-7 PFAM
Blast:BTB 254 406 2e-95 BLAST
BTB 420 518 3.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109606
SMART Domains Protein: ENSMUSP00000105235
Gene: ENSMUSG00000021589

DomainStartEndE-ValueType
Pfam:Ras 45 195 1.3e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000220939
AA Change: S84P
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RHOBTB3 is a member of the evolutionarily conserved RHOBTB subfamily of Rho GTPases. For background information on RHOBTBs, see RHOBTB1 (MIM 607351).[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality, reduced body weight and slightly reduced organ weights that varies by sex. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Rhobtb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rhobtb3 APN 13 75877428 missense probably damaging 1.00
IGL02142:Rhobtb3 APN 13 75877495 missense probably damaging 1.00
IGL02708:Rhobtb3 APN 13 75917724 missense probably damaging 0.99
IGL02732:Rhobtb3 APN 13 75910937 missense probably damaging 1.00
IGL02969:Rhobtb3 APN 13 75943431 missense probably damaging 1.00
R0048:Rhobtb3 UTSW 13 75902245 makesense probably null
R0285:Rhobtb3 UTSW 13 75877509 missense possibly damaging 0.86
R2233:Rhobtb3 UTSW 13 75872365 missense possibly damaging 0.76
R2289:Rhobtb3 UTSW 13 75910927 missense probably damaging 0.97
R3684:Rhobtb3 UTSW 13 75939481 missense probably damaging 1.00
R4685:Rhobtb3 UTSW 13 75878932 nonsense probably null
R5060:Rhobtb3 UTSW 13 75913270 missense probably benign
R5374:Rhobtb3 UTSW 13 75878895 missense probably damaging 0.98
R5688:Rhobtb3 UTSW 13 75872418 missense probably benign 0.01
R6181:Rhobtb3 UTSW 13 75910689 missense probably benign 0.05
R6235:Rhobtb3 UTSW 13 75892910 missense probably damaging 0.99
R6947:Rhobtb3 UTSW 13 75910666 missense probably benign 0.14
R7032:Rhobtb3 UTSW 13 75872394 missense probably benign 0.01
R7039:Rhobtb3 UTSW 13 75872453 nonsense probably null
R7148:Rhobtb3 UTSW 13 75910887 missense probably benign
R7449:Rhobtb3 UTSW 13 75910741 missense probably benign 0.14
R7508:Rhobtb3 UTSW 13 75878857 missense probably benign 0.00
R7598:Rhobtb3 UTSW 13 75910902 missense probably benign 0.00
R7691:Rhobtb3 UTSW 13 75878937 missense probably damaging 0.99
R7770:Rhobtb3 UTSW 13 75917815 missense probably damaging 0.99
R8465:Rhobtb3 UTSW 13 75939622 missense probably damaging 1.00
R9098:Rhobtb3 UTSW 13 75939583 missense probably damaging 1.00
R9133:Rhobtb3 UTSW 13 75872393 missense probably damaging 1.00
R9169:Rhobtb3 UTSW 13 75893002 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCGTCCTTAACAATAACAGGC -3'
(R):5'- TGTGCTTCAGTTATCCCTGATG -3'

Sequencing Primer
(F):5'- GTCCTTAACAATAACAGGCAATGGTG -3'
(R):5'- AGCTGAGGCATCACACTA -3'
Posted On 2014-10-30