Incidental Mutation 'R2332:Ghr'
ID 246482
Institutional Source Beutler Lab
Gene Symbol Ghr
Ensembl Gene ENSMUSG00000055737
Gene Name growth hormone receptor
Synonyms GHR/BP, GHBP
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 3317760-3583492 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3320409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 429 (N429S)
Ref Sequence ENSEMBL: ENSMUSP00000124064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069451] [ENSMUST00000161561]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069451
AA Change: N429S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000069457
Gene: ENSMUSG00000055737
AA Change: N429S

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 3.6e-12 PFAM
FN3 159 249 3.99e0 SMART
transmembrane domain 274 296 N/A INTRINSIC
Pfam:GHBP 325 636 2.1e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161561
AA Change: N429S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124064
Gene: ENSMUSG00000055737
AA Change: N429S

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 3.6e-12 PFAM
FN3 159 249 3.99e0 SMART
transmembrane domain 274 296 N/A INTRINSIC
Pfam:GHBP 325 628 1.8e-132 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family, which is a transmembrane receptor for growth hormone. Binding of growth hormone to the receptor leads to receptor dimerization and the activation of an intra- and intercellular signal transduction pathway leading to growth. Mutations in this gene have been associated with Laron syndrome, also known as the growth hormone insensitivity syndrome (GHIS), a disorder characterized by short stature. In humans and rabbits, but not rodents, growth hormone binding protein (GHBP) is generated by proteolytic cleavage of the extracellular ligand-binding domain from the mature growth hormone receptor protein. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded postnatal growth, proportionate dwarfism, decreased plasma insulin-like growth factor I levels, small pituitaries, reduced fecundity in females, and extended life-span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Ghr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ghr APN 15 3328120 missense probably benign 0.00
IGL01366:Ghr APN 15 3320187 missense probably damaging 1.00
IGL01446:Ghr APN 15 3333355 missense probably damaging 1.00
IGL01730:Ghr APN 15 3320584 missense probably damaging 1.00
IGL01908:Ghr APN 15 3320447 nonsense probably null
IGL02396:Ghr APN 15 3457998 start codon destroyed probably null 0.99
IGL02476:Ghr APN 15 3320046 missense probably damaging 1.00
IGL02863:Ghr APN 15 3328102 nonsense probably null
IGL03338:Ghr APN 15 3347542 missense probably damaging 1.00
Elfin UTSW 15 3340927 missense probably damaging 0.98
garden UTSW 15 3347572 missense probably benign 0.00
gnome UTSW 15 3388646 critical splice donor site probably null
R0334:Ghr UTSW 15 3341098 splice site probably benign
R0387:Ghr UTSW 15 3319891 missense probably benign
R0581:Ghr UTSW 15 3388634 splice site probably benign
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1216:Ghr UTSW 15 3319855 missense probably damaging 1.00
R1294:Ghr UTSW 15 3388646 critical splice donor site probably null
R1607:Ghr UTSW 15 3320574 missense probably damaging 1.00
R1743:Ghr UTSW 15 3320241 missense probably benign 0.06
R2006:Ghr UTSW 15 3327982 missense probably damaging 0.98
R2197:Ghr UTSW 15 3333474 nonsense probably null
R2274:Ghr UTSW 15 3320025 missense probably benign 0.00
R4283:Ghr UTSW 15 3333448 missense possibly damaging 0.73
R4519:Ghr UTSW 15 3333488 missense probably damaging 1.00
R4521:Ghr UTSW 15 3325958 missense probably damaging 1.00
R4714:Ghr UTSW 15 3320397 missense possibly damaging 0.91
R4717:Ghr UTSW 15 3319753 missense possibly damaging 0.81
R4724:Ghr UTSW 15 3325940 missense probably benign 0.31
R5087:Ghr UTSW 15 3320140 missense probably damaging 1.00
R5269:Ghr UTSW 15 3320079 missense probably benign 0.16
R5429:Ghr UTSW 15 3388675 nonsense probably null
R6012:Ghr UTSW 15 3340927 missense probably damaging 0.98
R6135:Ghr UTSW 15 3325965 missense probably benign 0.04
R6588:Ghr UTSW 15 3320268 missense probably benign 0.14
R7069:Ghr UTSW 15 3320484 missense probably damaging 1.00
R7074:Ghr UTSW 15 3333391 missense probably damaging 1.00
R7408:Ghr UTSW 15 3347572 missense probably benign 0.00
R7540:Ghr UTSW 15 3319914 missense possibly damaging 0.72
R7575:Ghr UTSW 15 3320512 missense probably damaging 1.00
R7822:Ghr UTSW 15 3457957 missense probably benign 0.00
R7922:Ghr UTSW 15 3341074 missense possibly damaging 0.56
R8221:Ghr UTSW 15 3333419 missense probably benign 0.37
R9041:Ghr UTSW 15 3328048 missense probably benign 0.31
R9074:Ghr UTSW 15 3340988 missense possibly damaging 0.76
X0017:Ghr UTSW 15 3320694 missense probably damaging 1.00
X0064:Ghr UTSW 15 3320212 missense possibly damaging 0.90
Z1176:Ghr UTSW 15 3347485 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTCGCTTACTTGGGCATAAAAG -3'
(R):5'- GACTGAAGGGTCTGACACAG -3'

Sequencing Primer
(F):5'- GGGCATAAAAGTCAATGTTTGCC -3'
(R):5'- GACAGACTTCTAAGCAATGATCATG -3'
Posted On 2014-10-30