Incidental Mutation 'R2332:Iqcb1'
ID 246486
Institutional Source Beutler Lab
Gene Symbol Iqcb1
Ensembl Gene ENSMUSG00000022837
Gene Name IQ calmodulin-binding motif containing 1
Synonyms 6820449I09Rik, NPHP5
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 36828385-36872721 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36843439 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 190 (N190D)
Ref Sequence ENSEMBL: ENSMUSP00000110467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023535] [ENSMUST00000075946] [ENSMUST00000114819]
AlphaFold Q8BP00
Predicted Effect possibly damaging
Transcript: ENSMUST00000023535
AA Change: N190D

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023535
Gene: ENSMUSG00000022837
AA Change: N190D

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114819
AA Change: N190D

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110467
Gene: ENSMUSG00000022837
AA Change: N190D

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232162
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nephrocystin protein that interacts with calmodulin and the retinitis pigmentosa GTPase regulator protein. The encoded protein has a central coiled-coil region and two calmodulin-binding IQ domains. It is localized to the primary cilia of renal epithelial cells and connecting cilia of photoreceptor cells. The protein is thought to play a role in ciliary function. Defects in this gene result in Senior-Loken syndrome type 5. Alternative splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Iqcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Iqcb1 APN 16 36858586 missense probably benign 0.04
IGL00539:Iqcb1 APN 16 36858511 missense probably damaging 1.00
IGL00763:Iqcb1 APN 16 36856287 splice site probably benign
IGL02247:Iqcb1 APN 16 36839896 missense probably benign 0.34
IGL02444:Iqcb1 APN 16 36831911 nonsense probably null
R0360:Iqcb1 UTSW 16 36872308 missense probably damaging 1.00
R1893:Iqcb1 UTSW 16 36831883 missense probably damaging 1.00
R2220:Iqcb1 UTSW 16 36843462 splice site probably null
R3833:Iqcb1 UTSW 16 36831914 nonsense probably null
R4841:Iqcb1 UTSW 16 36835590 missense probably benign 0.00
R4842:Iqcb1 UTSW 16 36835590 missense probably benign 0.00
R6574:Iqcb1 UTSW 16 36871501 missense probably damaging 1.00
R6612:Iqcb1 UTSW 16 36871661 unclassified probably benign
R6715:Iqcb1 UTSW 16 36835629 missense probably damaging 0.98
R6939:Iqcb1 UTSW 16 36839912 missense possibly damaging 0.80
R7620:Iqcb1 UTSW 16 36856410 missense probably benign
R7716:Iqcb1 UTSW 16 36867607 missense probably benign
R8247:Iqcb1 UTSW 16 36858474 missense probably benign 0.34
R8976:Iqcb1 UTSW 16 36871643 missense probably benign 0.03
R9081:Iqcb1 UTSW 16 36835644 missense probably null 0.98
R9404:Iqcb1 UTSW 16 36851270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGAAGTTTAGCAGAAATGATC -3'
(R):5'- GTCCATGAGACCTGATGAATAAACCC -3'

Sequencing Primer
(F):5'- AGCAGAAATGATCAAACTTTCATTTG -3'
(R):5'- GAGACCTGATGAATAAACCCATATTC -3'
Posted On 2014-10-30