Incidental Mutation 'R2332:Synj2'
ID 246487
Institutional Source Beutler Lab
Gene Symbol Synj2
Ensembl Gene ENSMUSG00000023805
Gene Name synaptojanin 2
Synonyms SJ2
MMRRC Submission 040322-MU
Accession Numbers

Genbank: NM_001113353.1, NM_001113352.1, NM_011523.2, NM_001113351.1

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 5941280-6044290 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6023794 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 288 (K288E)
Ref Sequence ENSEMBL: ENSMUSP00000122316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061091] [ENSMUST00000080283] [ENSMUST00000115784] [ENSMUST00000115785] [ENSMUST00000115786] [ENSMUST00000115787] [ENSMUST00000115788] [ENSMUST00000115789] [ENSMUST00000115790] [ENSMUST00000115791] [ENSMUST00000126881] [ENSMUST00000134767] [ENSMUST00000142409] [ENSMUST00000154114] [ENSMUST00000146009]
AlphaFold Q9D2G5
Predicted Effect possibly damaging
Transcript: ENSMUST00000061091
AA Change: K725E

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060382
Gene: ENSMUSG00000023805
AA Change: K725E

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 2.5e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000080283
AA Change: K810E

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079164
Gene: ENSMUSG00000023805
AA Change: K810E

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 5.5e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1167 1179 N/A INTRINSIC
low complexity region 1217 1234 N/A INTRINSIC
low complexity region 1263 1277 N/A INTRINSIC
low complexity region 1293 1306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115784
SMART Domains Protein: ENSMUSP00000111450
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 3e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115785
AA Change: K494E

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111451
Gene: ENSMUSG00000023805
AA Change: K494E

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 4e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 851 863 N/A INTRINSIC
low complexity region 901 918 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115786
SMART Domains Protein: ENSMUSP00000111452
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 5.3e-29 PFAM
Blast:IPPc 239 268 1e-6 BLAST
IPPc 288 525 6e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115787
SMART Domains Protein: ENSMUSP00000111453
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 5.7e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
low complexity region 977 994 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115788
SMART Domains Protein: ENSMUSP00000111454
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 4.8e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115789
SMART Domains Protein: ENSMUSP00000111455
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 187 2.3e-60 PFAM
Blast:IPPc 318 347 2e-6 BLAST
IPPc 367 709 3.72e-128 SMART
DUF1866 702 847 1.04e-73 SMART
low complexity region 850 864 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
low complexity region 1056 1073 N/A INTRINSIC
low complexity region 1102 1116 N/A INTRINSIC
low complexity region 1132 1145 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115790
AA Change: K725E

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111456
Gene: ENSMUSG00000023805
AA Change: K725E

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 3e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1223 1237 N/A INTRINSIC
low complexity region 1253 1266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115791
AA Change: K810E

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111457
Gene: ENSMUSG00000023805
AA Change: K810E

DomainStartEndE-ValueType
Pfam:Syja_N 61 343 8.5e-67 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1262 1279 N/A INTRINSIC
low complexity region 1308 1322 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126881
SMART Domains Protein: ENSMUSP00000115371
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
DUF1866 16 161 1.04e-73 SMART
low complexity region 164 178 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134767
Predicted Effect probably benign
Transcript: ENSMUST00000142409
AA Change: K570E

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120006
Gene: ENSMUSG00000023805
AA Change: K570E

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 2.5e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154114
AA Change: K288E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122316
Gene: ENSMUSG00000023805
AA Change: K288E

DomainStartEndE-ValueType
IPPc 6 348 3.72e-128 SMART
DUF1866 341 486 1.04e-73 SMART
low complexity region 489 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146009
AA Change: K810E

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122381
Gene: ENSMUSG00000023805
AA Change: K810E

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 3.6e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
Meta Mutation Damage Score 0.0902 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the inositol-polyphosphate 5-phosphatase family. The encoded protein interacts with the ras-related C3 botulinum toxin substrate 1, which causes translocation of the encoded protein to the plasma membrane where it inhibits clathrin-mediated endocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss and cochlear hair cell degeneration associated with fusion of stereocilia followed by total loss of hair bundles and cochlear ganglion degeneration. No vestibular dysfunction or other behavioral deficits are observed. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Synj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Synj2 APN 17 6037926 missense possibly damaging 0.48
IGL01399:Synj2 APN 17 6009771 missense probably damaging 1.00
IGL01793:Synj2 APN 17 6027225 nonsense probably null
IGL01793:Synj2 APN 17 6038046 missense probably benign 0.01
IGL02096:Synj2 APN 17 5990353 missense probably damaging 1.00
IGL02115:Synj2 APN 17 6017590 missense probably damaging 1.00
IGL02222:Synj2 APN 17 6037480 missense probably benign 0.04
IGL02478:Synj2 APN 17 6037924 missense probably benign 0.00
IGL02634:Synj2 APN 17 6029760 missense probably damaging 1.00
IGL02652:Synj2 APN 17 6017593 missense probably damaging 1.00
IGL02681:Synj2 APN 17 5990336 missense probably damaging 1.00
IGL02719:Synj2 APN 17 5996917 missense probably benign 0.02
IGL03253:Synj2 APN 17 6003159 splice site probably null
IGL03365:Synj2 APN 17 6019404 missense probably damaging 1.00
I2288:Synj2 UTSW 17 6022267 splice site probably benign
I2289:Synj2 UTSW 17 6022267 splice site probably benign
R0389:Synj2 UTSW 17 6029783 missense probably benign 0.35
R0433:Synj2 UTSW 17 6033848 missense probably damaging 1.00
R0530:Synj2 UTSW 17 6008105 missense possibly damaging 0.88
R0539:Synj2 UTSW 17 5996888 start codon destroyed probably null 0.63
R0556:Synj2 UTSW 17 6037955 nonsense probably null
R1263:Synj2 UTSW 17 6019359 missense probably damaging 0.99
R1443:Synj2 UTSW 17 6023665 missense probably damaging 0.99
R1450:Synj2 UTSW 17 6027324 splice site probably benign
R1532:Synj2 UTSW 17 6033919 missense probably benign 0.00
R1542:Synj2 UTSW 17 6025017 missense probably benign 0.01
R1809:Synj2 UTSW 17 6026551 missense possibly damaging 0.95
R1875:Synj2 UTSW 17 6028550 missense possibly damaging 0.69
R1897:Synj2 UTSW 17 6022137 nonsense probably null
R1928:Synj2 UTSW 17 5990267 missense probably damaging 0.99
R2008:Synj2 UTSW 17 5996946 missense probably damaging 1.00
R2060:Synj2 UTSW 17 6037480 missense probably benign 0.04
R2109:Synj2 UTSW 17 6013691 missense probably benign 0.00
R2413:Synj2 UTSW 17 6028574 missense probably damaging 1.00
R3684:Synj2 UTSW 17 6028443 missense probably damaging 0.97
R4111:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4113:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4654:Synj2 UTSW 17 6013538 missense probably damaging 1.00
R4797:Synj2 UTSW 17 6033888 missense probably damaging 1.00
R4812:Synj2 UTSW 17 6010664 missense probably damaging 1.00
R4873:Synj2 UTSW 17 5988068 intron probably benign
R4875:Synj2 UTSW 17 5988068 intron probably benign
R5110:Synj2 UTSW 17 6037715 missense probably benign 0.06
R5205:Synj2 UTSW 17 5941518 missense probably damaging 1.00
R5504:Synj2 UTSW 17 6036475 missense possibly damaging 0.85
R5593:Synj2 UTSW 17 6038115 makesense probably null
R5690:Synj2 UTSW 17 6035527 missense probably benign 0.00
R5870:Synj2 UTSW 17 6037853 missense probably benign 0.00
R6084:Synj2 UTSW 17 6017614 missense probably damaging 0.98
R6084:Synj2 UTSW 17 6038098 missense probably damaging 1.00
R6158:Synj2 UTSW 17 5986212 missense probably benign 0.00
R6159:Synj2 UTSW 17 5986052 missense probably damaging 1.00
R6160:Synj2 UTSW 17 6008061 missense possibly damaging 0.92
R6278:Synj2 UTSW 17 5975874 missense probably damaging 1.00
R6406:Synj2 UTSW 17 6019571 intron probably benign
R6531:Synj2 UTSW 17 6033839 missense probably damaging 1.00
R6729:Synj2 UTSW 17 5986014 start codon destroyed probably null 1.00
R6774:Synj2 UTSW 17 6038015 missense possibly damaging 0.87
R6792:Synj2 UTSW 17 5990290 missense probably benign 0.01
R6844:Synj2 UTSW 17 5975806 missense probably damaging 0.96
R6865:Synj2 UTSW 17 6017569 nonsense probably null
R7178:Synj2 UTSW 17 6026479 missense possibly damaging 0.95
R7286:Synj2 UTSW 17 6037945 missense possibly damaging 0.79
R7403:Synj2 UTSW 17 6037730 missense possibly damaging 0.76
R7451:Synj2 UTSW 17 6029791 missense possibly damaging 0.68
R7501:Synj2 UTSW 17 5990239 missense possibly damaging 0.79
R7730:Synj2 UTSW 17 6016287 missense probably benign 0.33
R7799:Synj2 UTSW 17 6037823 missense probably benign 0.10
R7804:Synj2 UTSW 17 6019534 missense unknown
R7841:Synj2 UTSW 17 6044144 missense unknown
R8347:Synj2 UTSW 17 6009785 missense probably damaging 1.00
R8358:Synj2 UTSW 17 6023805 nonsense probably null
R8391:Synj2 UTSW 17 5941521 missense probably damaging 0.99
R8725:Synj2 UTSW 17 6037740 missense possibly damaging 0.48
R8787:Synj2 UTSW 17 5986239 missense possibly damaging 0.57
R8877:Synj2 UTSW 17 6037666 missense probably damaging 1.00
R9091:Synj2 UTSW 17 6017600 missense possibly damaging 0.88
R9121:Synj2 UTSW 17 5990324 missense probably damaging 1.00
R9147:Synj2 UTSW 17 6033897 missense probably damaging 1.00
R9148:Synj2 UTSW 17 6033897 missense probably damaging 1.00
R9270:Synj2 UTSW 17 6017600 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCAGGAAGAGACATGTCTGTGTG -3'
(R):5'- GAGGCGGTTCAAAAGCTATGAC -3'

Sequencing Primer
(F):5'- AGAGACATGTCTGTGTGTGTAAAGTC -3'
(R):5'- GCGGTTCAAAAGCTATGACATCTAG -3'
Posted On 2014-10-30