Incidental Mutation 'R2332:Pacsin1'
ID 246489
Institutional Source Beutler Lab
Gene Symbol Pacsin1
Ensembl Gene ENSMUSG00000040276
Gene Name protein kinase C and casein kinase substrate in neurons 1
Synonyms A830061D09Rik, Syndapin I
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 27655509-27711482 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27704911 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 93 (E93G)
Ref Sequence ENSEMBL: ENSMUSP00000155999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045896] [ENSMUST00000097360] [ENSMUST00000114872] [ENSMUST00000114873] [ENSMUST00000231236] [ENSMUST00000231669] [ENSMUST00000232437]
AlphaFold Q61644
Predicted Effect possibly damaging
Transcript: ENSMUST00000045896
AA Change: E93G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044168
Gene: ENSMUSG00000040276
AA Change: E93G

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097360
AA Change: E93G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094973
Gene: ENSMUSG00000040276
AA Change: E93G

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114872
SMART Domains Protein: ENSMUSP00000110522
Gene: ENSMUSG00000040276

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114873
AA Change: E93G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110523
Gene: ENSMUSG00000040276
AA Change: E93G

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231236
AA Change: E93G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231350
Predicted Effect possibly damaging
Transcript: ENSMUST00000231669
AA Change: E93G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232225
Predicted Effect possibly damaging
Transcript: ENSMUST00000232437
AA Change: E93G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.2618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Homozygotes for a gene trapped allele show altered type I interferon responses in plasmacytoid dendritic cells. Homozygotes for a null allele show impaired synaptic vesicle formation, synaptic transmission and neuronal network activity, and develop generalized seizures with tonic-clonic convulsions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Pacsin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Pacsin1 APN 17 27704835 splice site probably null
IGL02752:Pacsin1 APN 17 27702698 critical splice acceptor site probably null
R1428:Pacsin1 UTSW 17 27705963 missense probably damaging 1.00
R4349:Pacsin1 UTSW 17 27707004 missense possibly damaging 0.52
R4664:Pacsin1 UTSW 17 27707064 missense probably damaging 1.00
R5568:Pacsin1 UTSW 17 27708048 missense probably damaging 1.00
R5936:Pacsin1 UTSW 17 27704997 missense probably benign 0.16
R5943:Pacsin1 UTSW 17 27706071 missense probably damaging 1.00
R6277:Pacsin1 UTSW 17 27705995 splice site probably null
R6284:Pacsin1 UTSW 17 27708504 missense probably damaging 1.00
R6376:Pacsin1 UTSW 17 27707905 missense probably benign 0.33
R7134:Pacsin1 UTSW 17 27702733 missense probably damaging 1.00
R7972:Pacsin1 UTSW 17 27708639 missense unknown
R8141:Pacsin1 UTSW 17 27707060 missense possibly damaging 0.78
R9263:Pacsin1 UTSW 17 27704950 missense probably damaging 1.00
R9316:Pacsin1 UTSW 17 27705733 missense possibly damaging 0.77
R9414:Pacsin1 UTSW 17 27708011 missense probably damaging 0.99
Z1177:Pacsin1 UTSW 17 27708438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTTGCCATGGGAAGAGAG -3'
(R):5'- GATGCTGGCATTCCCTTGTG -3'

Sequencing Primer
(F):5'- GGGGGAAGTGTCAGAGAGG -3'
(R):5'- ACAGATGCCCTCCTGTGAC -3'
Posted On 2014-10-30