Incidental Mutation 'R0284:Lipn'
ID 24649
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Name lipase, family member N
Synonyms 2210418G03Rik, Lipl4
MMRRC Submission 038505-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0284 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 34044758-34062318 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34058106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 276 (S276G)
Ref Sequence ENSEMBL: ENSMUSP00000025682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000148821]
AlphaFold Q3U4B4
Predicted Effect possibly damaging
Transcript: ENSMUST00000025682
AA Change: S276G

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: S276G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Meta Mutation Damage Score 0.5791 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.4%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh6 A G 7: 30,013,413 (GRCm39) T161A probably benign Het
Alox12e A G 11: 70,211,725 (GRCm39) probably benign Het
Ap1g2 A G 14: 55,339,149 (GRCm39) probably benign Het
Arid2 A T 15: 96,276,848 (GRCm39) probably benign Het
Bmp2k A T 5: 97,216,314 (GRCm39) H604L unknown Het
Cacna1a A T 8: 85,338,914 (GRCm39) M1705L probably damaging Het
Cacna1d A T 14: 29,794,062 (GRCm39) D1526E probably damaging Het
Ccdc171 A G 4: 83,467,975 (GRCm39) R107G possibly damaging Het
Cklf T C 8: 104,988,207 (GRCm39) probably benign Het
Crabp1 A G 9: 54,672,210 (GRCm39) K9E probably benign Het
Cspg4 A G 9: 56,793,423 (GRCm39) D386G probably damaging Het
Cyp3a41b G A 5: 145,515,014 (GRCm39) probably benign Het
Dsg1a T A 18: 20,464,684 (GRCm39) V393E probably damaging Het
Ednrb C T 14: 104,057,449 (GRCm39) G371D probably damaging Het
Efcab5 T C 11: 76,994,353 (GRCm39) probably benign Het
Exoc2 A T 13: 31,061,608 (GRCm39) probably benign Het
Fbn2 G A 18: 58,183,362 (GRCm39) probably benign Het
Foxo6 T C 4: 120,126,199 (GRCm39) S199G probably benign Het
Fpr1 T A 17: 18,097,618 (GRCm39) I124F probably damaging Het
Gk5 A T 9: 96,063,823 (GRCm39) probably null Het
Gys1 A T 7: 45,086,143 (GRCm39) probably benign Het
Igfbp1 T C 11: 7,148,103 (GRCm39) S49P probably damaging Het
Incenp A T 19: 9,871,357 (GRCm39) S91T unknown Het
Itpkc G A 7: 26,913,968 (GRCm39) R498* probably null Het
Kat6a A G 8: 23,429,819 (GRCm39) T1725A unknown Het
Kiz T A 2: 146,705,730 (GRCm39) C97S probably benign Het
Kri1 A G 9: 21,187,848 (GRCm39) probably benign Het
Llgl1 A G 11: 60,602,967 (GRCm39) T881A probably damaging Het
Man1a2 T C 3: 100,592,102 (GRCm39) H26R probably damaging Het
Map3k5 T A 10: 19,876,359 (GRCm39) F173I probably damaging Het
Miox C T 15: 89,220,477 (GRCm39) L189F possibly damaging Het
Mipol1 A G 12: 57,503,855 (GRCm39) Q341R probably damaging Het
Mllt6 G T 11: 97,569,431 (GRCm39) A928S probably benign Het
Ncoa6 TGC TGCGC 2: 155,250,211 (GRCm39) probably null Het
Nipsnap3a C T 4: 52,997,178 (GRCm39) T150I probably benign Het
Nsl1 A G 1: 190,797,427 (GRCm39) E97G probably damaging Het
Or11j4 G A 14: 50,630,452 (GRCm39) V80M probably damaging Het
Or4f54 T C 2: 111,122,931 (GRCm39) V106A probably benign Het
Or7g18 A T 9: 18,786,848 (GRCm39) Y72F probably benign Het
Or8c11 G A 9: 38,289,880 (GRCm39) M234I probably benign Het
Pakap T C 4: 57,855,207 (GRCm39) F220L probably damaging Het
Pdcd6ip A G 9: 113,491,572 (GRCm39) L552S probably damaging Het
Plekhf2 T C 4: 10,990,595 (GRCm39) probably benign Het
Prdm1 T C 10: 44,332,622 (GRCm39) E96G probably damaging Het
Prpf40a T A 2: 53,040,659 (GRCm39) E608D probably damaging Het
Prpf40b A T 15: 99,214,274 (GRCm39) probably benign Het
Rag2 T C 2: 101,460,464 (GRCm39) V258A probably damaging Het
S100a5 A G 3: 90,518,881 (GRCm39) I68V probably benign Het
Serpinb8 G A 1: 107,530,648 (GRCm39) probably null Het
Slc24a4 T C 12: 102,226,740 (GRCm39) V492A probably damaging Het
Spag6l T A 16: 16,598,630 (GRCm39) Q287L probably damaging Het
Spmip6 T G 4: 41,507,538 (GRCm39) E150A probably damaging Het
Synpo2 C T 3: 122,873,383 (GRCm39) W211* probably null Het
Tgtp1 A G 11: 48,877,970 (GRCm39) V245A probably benign Het
Tmem144 G A 3: 79,746,580 (GRCm39) probably benign Het
Trerf1 A G 17: 47,630,471 (GRCm39) noncoding transcript Het
Ttn G C 2: 76,677,048 (GRCm39) probably benign Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Vps13d A T 4: 144,871,372 (GRCm39) M1900K probably benign Het
Vps41 A T 13: 19,037,610 (GRCm39) D691V probably damaging Het
Zfp518b T C 5: 38,829,083 (GRCm39) Y974C probably damaging Het
Zscan29 A T 2: 120,997,214 (GRCm39) probably benign Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34,056,435 (GRCm39) missense probably benign 0.06
IGL01320:Lipn APN 19 34,062,040 (GRCm39) missense probably benign 0.07
IGL01827:Lipn APN 19 34,046,880 (GRCm39) missense probably damaging 1.00
IGL02252:Lipn APN 19 34,049,157 (GRCm39) missense probably benign 0.01
IGL02422:Lipn APN 19 34,046,063 (GRCm39) missense probably benign 0.00
R0081:Lipn UTSW 19 34,054,376 (GRCm39) missense probably benign 0.00
R0539:Lipn UTSW 19 34,062,003 (GRCm39) unclassified probably benign
R0749:Lipn UTSW 19 34,054,379 (GRCm39) missense probably damaging 1.00
R1170:Lipn UTSW 19 34,049,158 (GRCm39) missense probably benign 0.23
R1528:Lipn UTSW 19 34,046,070 (GRCm39) missense probably damaging 0.96
R1621:Lipn UTSW 19 34,046,113 (GRCm39) missense probably benign
R1675:Lipn UTSW 19 34,058,110 (GRCm39) missense probably damaging 1.00
R1869:Lipn UTSW 19 34,058,139 (GRCm39) missense possibly damaging 0.93
R3236:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3237:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3832:Lipn UTSW 19 34,046,933 (GRCm39) critical splice donor site probably null
R3876:Lipn UTSW 19 34,046,828 (GRCm39) missense probably benign 0.00
R4084:Lipn UTSW 19 34,056,340 (GRCm39) missense probably benign 0.04
R4595:Lipn UTSW 19 34,058,750 (GRCm39) missense probably damaging 1.00
R5963:Lipn UTSW 19 34,058,700 (GRCm39) missense probably damaging 0.97
R6018:Lipn UTSW 19 34,054,335 (GRCm39) missense probably damaging 1.00
R6797:Lipn UTSW 19 34,058,160 (GRCm39) missense probably benign
R7090:Lipn UTSW 19 34,049,180 (GRCm39) missense possibly damaging 0.72
R7157:Lipn UTSW 19 34,054,390 (GRCm39) nonsense probably null
R7458:Lipn UTSW 19 34,049,242 (GRCm39) missense probably benign 0.10
R8824:Lipn UTSW 19 34,062,116 (GRCm39) missense probably benign 0.04
R8894:Lipn UTSW 19 34,062,248 (GRCm39) makesense probably null
R8933:Lipn UTSW 19 34,046,880 (GRCm39) missense probably damaging 0.98
R9054:Lipn UTSW 19 34,054,376 (GRCm39) missense possibly damaging 0.56
R9117:Lipn UTSW 19 34,046,041 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGACTTTGTGTAGGTTCCCCGC -3'
(R):5'- AGCTTCAGCTTGCCTCAGTGTACC -3'

Sequencing Primer
(F):5'- GCCCCCTCAGGAAACACTTC -3'
(R):5'- CCAGCTCTAGCTTAAAATGGCATTG -3'
Posted On 2013-04-16