Incidental Mutation 'R2332:Uhrf1'
ID 246490
Institutional Source Beutler Lab
Gene Symbol Uhrf1
Ensembl Gene ENSMUSG00000001228
Gene Name ubiquitin-like, containing PHD and RING finger domains, 1
Synonyms ICBP90, Np95
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 56303321-56323486 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 56310671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001258] [ENSMUST00000113035] [ENSMUST00000113038] [ENSMUST00000113039] [ENSMUST00000142387]
AlphaFold Q8VDF2
Predicted Effect probably null
Transcript: ENSMUST00000001258
SMART Domains Protein: ENSMUSP00000001258
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113035
SMART Domains Protein: ENSMUSP00000108658
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113038
SMART Domains Protein: ENSMUSP00000108661
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113039
SMART Domains Protein: ENSMUSP00000108662
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:TTD 128 281 8e-61 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137876
Predicted Effect probably null
Transcript: ENSMUST00000142387
SMART Domains Protein: ENSMUSP00000125830
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. The protein binds to specific DNA sequences, and recruits a histone deacetylase to regulate gene expression. Its expression peaks at late G1 phase and continues during G2 and M phases of the cell cycle. It plays a major role in the G1/S transition by regulating topoisomerase IIalpha and retinoblastoma gene expression, and functions in the p53-dependent DNA damage checkpoint. It is regarded as a hub protein for the integration of epigenetic information. This gene is up-regulated in various cancers, and it is therefore considered to be a therapeutic target. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 12. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruption of this marker die early in gestation showing growth retardation and various malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Uhrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Uhrf1 APN 17 56318125 missense probably damaging 1.00
IGL00925:Uhrf1 APN 17 56320535 missense probably benign 0.00
IGL01432:Uhrf1 APN 17 56318250 missense probably damaging 1.00
IGL02739:Uhrf1 APN 17 56305129 missense probably benign 0.03
R0667:Uhrf1 UTSW 17 56310677 missense probably benign 0.01
R0685:Uhrf1 UTSW 17 56310742 missense probably damaging 0.99
R1121:Uhrf1 UTSW 17 56312917 missense probably benign
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R2088:Uhrf1 UTSW 17 56318089 missense probably damaging 1.00
R2329:Uhrf1 UTSW 17 56310671 splice site probably null
R2331:Uhrf1 UTSW 17 56310671 splice site probably null
R3624:Uhrf1 UTSW 17 56317023 missense probably damaging 1.00
R4065:Uhrf1 UTSW 17 56318020 missense probably damaging 1.00
R4882:Uhrf1 UTSW 17 56309401 missense probably damaging 1.00
R4901:Uhrf1 UTSW 17 56310834 missense probably benign 0.01
R4913:Uhrf1 UTSW 17 56315478 missense probably damaging 0.99
R5061:Uhrf1 UTSW 17 56320542 splice site probably null
R5186:Uhrf1 UTSW 17 56318340 missense probably damaging 1.00
R5711:Uhrf1 UTSW 17 56320259 missense possibly damaging 0.49
R6917:Uhrf1 UTSW 17 56309574 missense probably damaging 1.00
R7021:Uhrf1 UTSW 17 56320450 missense probably benign 0.04
R7241:Uhrf1 UTSW 17 56315193 missense probably damaging 1.00
R7692:Uhrf1 UTSW 17 56312905 missense possibly damaging 0.91
R7875:Uhrf1 UTSW 17 56312884 missense possibly damaging 0.46
R8540:Uhrf1 UTSW 17 56305105 missense probably damaging 1.00
R8731:Uhrf1 UTSW 17 56322363 missense probably damaging 1.00
R8897:Uhrf1 UTSW 17 56310817 missense probably damaging 1.00
R9349:Uhrf1 UTSW 17 56310737 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAGCAGAGGTCTCTTGCAG -3'
(R):5'- GGCACTCACTCATCATACTTGAC -3'

Sequencing Primer
(F):5'- CATCCAGTGTCCATAGTGCTGAG -3'
(R):5'- CACTCATCATACTTGACATGGTAC -3'
Posted On 2014-10-30