Incidental Mutation 'R2332:Banf1'
ID 246492
Institutional Source Beutler Lab
Gene Symbol Banf1
Ensembl Gene ENSMUSG00000024844
Gene Name barrier to autointegration factor 1
Synonyms C78287, Bcrp1
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 5364641-5366645 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 5365030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 84 (W84*)
Ref Sequence ENSEMBL: ENSMUSP00000126202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025759] [ENSMUST00000025762] [ENSMUST00000170010]
AlphaFold O54962
Predicted Effect probably benign
Transcript: ENSMUST00000025759
SMART Domains Protein: ENSMUSP00000025759
Gene: ENSMUSG00000024841

DomainStartEndE-ValueType
eIF1a 20 103 1.03e-40 SMART
low complexity region 131 142 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000025762
AA Change: W84*
SMART Domains Protein: ENSMUSP00000025762
Gene: ENSMUSG00000024844
AA Change: W84*

DomainStartEndE-ValueType
BAF 1 88 3.68e-59 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170010
AA Change: W84*
SMART Domains Protein: ENSMUSP00000126202
Gene: ENSMUSG00000024844
AA Change: W84*

DomainStartEndE-ValueType
BAF 1 88 3.68e-59 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was first identified by its ability to protect retroviruses from intramolecular integration and therefore promote intermolecular integration into the host cell genome. The protein forms a homodimer which localizes to both the nucleus and cytoplasm and is specifically associated with chromosomes during mitosis. This protein binds to double stranded DNA in a non-specific manner and also binds to LEM-domain containing proteins of the nuclear envelope. This protein is thought to facilitate nuclear reassembly by binding with both DNA and inner nuclear membrane proteins and thereby recruit chromatin to the nuclear periphery. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Banf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Banf1 APN 19 5365070 missense probably benign 0.00
R4671:Banf1 UTSW 19 5365844 missense probably benign 0.12
R7772:Banf1 UTSW 19 5365122 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCCCAGAAAGATTGAAACGCTG -3'
(R):5'- AGCTTCAGAGATCTGGCCTC -3'

Sequencing Primer
(F):5'- CGCTGAGGGGAGAGAACTC -3'
(R):5'- TATCAGCGTGGACAGTCCTG -3'
Posted On 2014-10-30