Incidental Mutation 'R2333:Zfp324'
ID246500
Institutional Source Beutler Lab
Gene Symbol Zfp324
Ensembl Gene ENSMUSG00000004500
Gene Namezinc finger protein 324
SynonymsD430030K24Rik, ZF5128
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2333 (G1)
Quality Score109
Status Not validated
Chromosome7
Chromosomal Location12965838-12974236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12971245 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 454 (T454A)
Ref Sequence ENSEMBL: ENSMUSP00000041944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038701] [ENSMUST00000124387] [ENSMUST00000128293] [ENSMUST00000210619]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038701
AA Change: T454A

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041944
Gene: ENSMUSG00000004500
AA Change: T454A

DomainStartEndE-ValueType
KRAB 31 91 8.89e-30 SMART
ZnF_C2H2 291 313 2.95e-3 SMART
ZnF_C2H2 319 341 1.82e-3 SMART
ZnF_C2H2 347 369 6.88e-4 SMART
ZnF_C2H2 375 397 1.95e-3 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 453 2.95e-3 SMART
ZnF_C2H2 459 481 2.75e-3 SMART
ZnF_C2H2 487 509 1.25e-1 SMART
ZnF_C2H2 515 537 7.37e-4 SMART
low complexity region 564 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124387
Predicted Effect probably benign
Transcript: ENSMUST00000128293
SMART Domains Protein: ENSMUSP00000124620
Gene: ENSMUSG00000004500

DomainStartEndE-ValueType
KRAB 31 75 3.83e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210619
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,511 I685K probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Brd4 C T 17: 32,221,457 D302N probably damaging Het
Celsr2 T C 3: 108,398,605 N2061S probably benign Het
Col1a2 A T 6: 4,532,747 M791L unknown Het
Dmxl1 A G 18: 49,919,976 probably null Het
Grm1 A G 10: 10,719,346 V846A probably damaging Het
Grm1 G A 10: 10,719,619 A755V probably benign Het
Ikbkap A G 4: 56,775,456 V701A probably benign Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Naip5 A G 13: 100,223,171 I519T probably damaging Het
Tmem100 A G 11: 90,035,598 I84V probably benign Het
Tnik C T 3: 28,532,996 R139W probably damaging Het
Vmn1r203 A G 13: 22,524,943 D298G probably damaging Het
Other mutations in Zfp324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Zfp324 APN 7 12969435 missense probably benign 0.02
IGL01943:Zfp324 APN 7 12968786 splice site probably benign
IGL02668:Zfp324 APN 7 12970846 missense probably damaging 1.00
R0883:Zfp324 UTSW 7 12971024 missense probably damaging 1.00
R0931:Zfp324 UTSW 7 12966258 missense probably benign 0.05
R1164:Zfp324 UTSW 7 12971624 missense probably benign 0.02
R1587:Zfp324 UTSW 7 12970643 missense possibly damaging 0.63
R1837:Zfp324 UTSW 7 12970229 missense probably benign 0.15
R1982:Zfp324 UTSW 7 12971218 missense probably damaging 1.00
R3155:Zfp324 UTSW 7 12968890 missense probably damaging 1.00
R4050:Zfp324 UTSW 7 12970867 missense probably damaging 1.00
R4784:Zfp324 UTSW 7 12971306 missense probably damaging 1.00
R4992:Zfp324 UTSW 7 12969373 missense probably benign 0.02
R5970:Zfp324 UTSW 7 12969366 missense probably benign 0.28
R6767:Zfp324 UTSW 7 12970600 missense probably null 0.13
R7007:Zfp324 UTSW 7 12971215 missense probably damaging 1.00
R7152:Zfp324 UTSW 7 12966271 missense probably benign 0.07
R7164:Zfp324 UTSW 7 12968883 missense probably damaging 0.97
R7233:Zfp324 UTSW 7 12970597 nonsense probably null
X0062:Zfp324 UTSW 7 12971389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGAGTGTGGTAAGGCCTTC -3'
(R):5'- TTCTCACCCGTGTGGATACG -3'

Sequencing Primer
(F):5'- CGGCTCCAACCTCAGTCAG -3'
(R):5'- GCCTGTGGCTGAGCAACAC -3'
Posted On2014-10-30