Incidental Mutation 'R2333:Zfp324'
ID 246500
Institutional Source Beutler Lab
Gene Symbol Zfp324
Ensembl Gene ENSMUSG00000004500
Gene Name zinc finger protein 324
Synonyms D430030K24Rik, ZF5128
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R2333 (G1)
Quality Score 109
Status Not validated
Chromosome 7
Chromosomal Location 12965838-12974236 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12971245 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 454 (T454A)
Ref Sequence ENSEMBL: ENSMUSP00000041944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038701] [ENSMUST00000124387] [ENSMUST00000128293] [ENSMUST00000210619]
AlphaFold Q78F42
Predicted Effect possibly damaging
Transcript: ENSMUST00000038701
AA Change: T454A

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041944
Gene: ENSMUSG00000004500
AA Change: T454A

DomainStartEndE-ValueType
KRAB 31 91 8.89e-30 SMART
ZnF_C2H2 291 313 2.95e-3 SMART
ZnF_C2H2 319 341 1.82e-3 SMART
ZnF_C2H2 347 369 6.88e-4 SMART
ZnF_C2H2 375 397 1.95e-3 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 453 2.95e-3 SMART
ZnF_C2H2 459 481 2.75e-3 SMART
ZnF_C2H2 487 509 1.25e-1 SMART
ZnF_C2H2 515 537 7.37e-4 SMART
low complexity region 564 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124387
Predicted Effect probably benign
Transcript: ENSMUST00000128293
SMART Domains Protein: ENSMUSP00000124620
Gene: ENSMUSG00000004500

DomainStartEndE-ValueType
KRAB 31 75 3.83e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210619
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,511 I685K probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Brd4 C T 17: 32,221,457 D302N probably damaging Het
Celsr2 T C 3: 108,398,605 N2061S probably benign Het
Col1a2 A T 6: 4,532,747 M791L unknown Het
Dmxl1 A G 18: 49,919,976 probably null Het
Grm1 A G 10: 10,719,346 V846A probably damaging Het
Grm1 G A 10: 10,719,619 A755V probably benign Het
Ikbkap A G 4: 56,775,456 V701A probably benign Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Naip5 A G 13: 100,223,171 I519T probably damaging Het
Tmem100 A G 11: 90,035,598 I84V probably benign Het
Tnik C T 3: 28,532,996 R139W probably damaging Het
Vmn1r203 A G 13: 22,524,943 D298G probably damaging Het
Other mutations in Zfp324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Zfp324 APN 7 12969435 missense probably benign 0.02
IGL01943:Zfp324 APN 7 12968786 splice site probably benign
IGL02668:Zfp324 APN 7 12970846 missense probably damaging 1.00
R0883:Zfp324 UTSW 7 12971024 missense probably damaging 1.00
R0931:Zfp324 UTSW 7 12966258 missense probably benign 0.05
R1164:Zfp324 UTSW 7 12971624 missense probably benign 0.02
R1587:Zfp324 UTSW 7 12970643 missense possibly damaging 0.63
R1837:Zfp324 UTSW 7 12970229 missense probably benign 0.15
R1982:Zfp324 UTSW 7 12971218 missense probably damaging 1.00
R3155:Zfp324 UTSW 7 12968890 missense probably damaging 1.00
R4050:Zfp324 UTSW 7 12970867 missense probably damaging 1.00
R4784:Zfp324 UTSW 7 12971306 missense probably damaging 1.00
R4992:Zfp324 UTSW 7 12969373 missense probably benign 0.02
R5970:Zfp324 UTSW 7 12969366 missense probably benign 0.28
R6767:Zfp324 UTSW 7 12970600 missense probably null 0.13
R7007:Zfp324 UTSW 7 12971215 missense probably damaging 1.00
R7152:Zfp324 UTSW 7 12966271 missense probably benign 0.07
R7164:Zfp324 UTSW 7 12968883 missense probably damaging 0.97
R7233:Zfp324 UTSW 7 12970597 nonsense probably null
R9039:Zfp324 UTSW 7 12971528 missense probably benign 0.19
R9172:Zfp324 UTSW 7 12970762 missense probably damaging 1.00
X0062:Zfp324 UTSW 7 12971389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGAGTGTGGTAAGGCCTTC -3'
(R):5'- TTCTCACCCGTGTGGATACG -3'

Sequencing Primer
(F):5'- CGGCTCCAACCTCAGTCAG -3'
(R):5'- GCCTGTGGCTGAGCAACAC -3'
Posted On 2014-10-30