Incidental Mutation 'R2333:Vmn1r203'
ID246506
Institutional Source Beutler Lab
Gene Symbol Vmn1r203
Ensembl Gene ENSMUSG00000069289
Gene Namevomeronasal 1 receptor 203
SynonymsV1rh11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2333 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location22518114-22531992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22524943 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 298 (D298G)
Ref Sequence ENSEMBL: ENSMUSP00000154399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091729] [ENSMUST00000227520] [ENSMUST00000228889]
Predicted Effect probably damaging
Transcript: ENSMUST00000091729
AA Change: D298G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089322
Gene: ENSMUSG00000069289
AA Change: D298G

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
Pfam:V1R 43 304 5.8e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137651
Predicted Effect probably damaging
Transcript: ENSMUST00000227520
AA Change: D298G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228889
AA Change: D298G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,511 I685K probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Brd4 C T 17: 32,221,457 D302N probably damaging Het
Celsr2 T C 3: 108,398,605 N2061S probably benign Het
Col1a2 A T 6: 4,532,747 M791L unknown Het
Dmxl1 A G 18: 49,919,976 probably null Het
Grm1 A G 10: 10,719,346 V846A probably damaging Het
Grm1 G A 10: 10,719,619 A755V probably benign Het
Ikbkap A G 4: 56,775,456 V701A probably benign Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Naip5 A G 13: 100,223,171 I519T probably damaging Het
Tmem100 A G 11: 90,035,598 I84V probably benign Het
Tnik C T 3: 28,532,996 R139W probably damaging Het
Zfp324 A G 7: 12,971,245 T454A possibly damaging Het
Other mutations in Vmn1r203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Vmn1r203 APN 13 22524777 missense probably damaging 1.00
IGL01527:Vmn1r203 APN 13 22524277 missense possibly damaging 0.89
IGL01808:Vmn1r203 APN 13 22524547 missense probably benign 0.02
IGL01887:Vmn1r203 APN 13 22524876 missense probably benign 0.00
IGL02340:Vmn1r203 APN 13 22524827 nonsense probably null
IGL02543:Vmn1r203 APN 13 22524904 missense probably damaging 1.00
IGL02684:Vmn1r203 APN 13 22524369 missense possibly damaging 0.95
BB005:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
BB015:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
PIT4519001:Vmn1r203 UTSW 13 22524595 missense probably benign 0.01
R0544:Vmn1r203 UTSW 13 22524273 missense possibly damaging 0.94
R1365:Vmn1r203 UTSW 13 22524586 missense probably benign 0.00
R1396:Vmn1r203 UTSW 13 22524508 missense probably benign 0.01
R1794:Vmn1r203 UTSW 13 22524351 missense probably damaging 1.00
R2010:Vmn1r203 UTSW 13 22524447 missense possibly damaging 0.56
R2169:Vmn1r203 UTSW 13 22524735 nonsense probably null
R2418:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R2419:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R4322:Vmn1r203 UTSW 13 22524238 missense probably damaging 1.00
R4460:Vmn1r203 UTSW 13 22524682 missense probably damaging 0.98
R4686:Vmn1r203 UTSW 13 22524358 missense probably damaging 1.00
R5526:Vmn1r203 UTSW 13 22524103 missense probably benign 0.01
R6240:Vmn1r203 UTSW 13 22524729 missense possibly damaging 0.89
R6607:Vmn1r203 UTSW 13 22524721 missense probably benign 0.23
R7575:Vmn1r203 UTSW 13 22524418 missense probably benign 0.12
R7928:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
R8375:Vmn1r203 UTSW 13 22524984 makesense probably null
Z1177:Vmn1r203 UTSW 13 22524409 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAGAACTCCAAGCTTCTCTACAG -3'
(R):5'- TCTCAGATCAAGGGTGTGAAAC -3'

Sequencing Primer
(F):5'- AGAACTCCCCCTGAGCTGAGAG -3'
(R):5'- GTGTGAAACAATAAGAAGATTGTCTG -3'
Posted On2014-10-30