Mutagenetix > Incidental Mutation

Incidental Mutation 'R2333:Vmn1r203'

246506

Institutional Source

Beutler Lab

Gene Symbol

Vmn1r203

Ensembl Gene

ENSMUSG00000069289

Gene Name

vomeronasal 1 receptor 203

Synonyms

V1rh11

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R2333 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22518114-22531992 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22524943 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 298 (D298G)

Ref Sequence

ENSEMBL: ENSMUSP00000154399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091729] [ENSMUST00000227520] [ENSMUST00000228889]

AlphaFold

Q8R273

Predicted Effect

probably damaging
Transcript: ENSMUST00000091729
AA Change: D298G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089322
Gene: ENSMUSG00000069289
AA Change: D298G

Domain	Start	End	E-Value	Type
transmembrane domain	19	41	N/A	INTRINSIC
Pfam:V1R	43	304	5.8e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137651

Predicted Effect

probably damaging
Transcript: ENSMUST00000227520
AA Change: D298G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228889
AA Change: D298G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.0%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,327,511	I685K	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Brd4	C	T	17: 32,221,457	D302N	probably damaging	Het
Celsr2	T	C	3: 108,398,605	N2061S	probably benign	Het
Col1a2	A	T	6: 4,532,747	M791L	unknown	Het
Dmxl1	A	G	18: 49,919,976		probably null	Het
Grm1	A	G	10: 10,719,346	V846A	probably damaging	Het
Grm1	G	A	10: 10,719,619	A755V	probably benign	Het
Ikbkap	A	G	4: 56,775,456	V701A	probably benign	Het
Ltbp4	C	T	7: 27,327,778	R389Q	possibly damaging	Het
Naip5	A	G	13: 100,223,171	I519T	probably damaging	Het
Tmem100	A	G	11: 90,035,598	I84V	probably benign	Het
Tnik	C	T	3: 28,532,996	R139W	probably damaging	Het
Zfp324	A	G	7: 12,971,245	T454A	possibly damaging	Het

Other mutations in Vmn1r203

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01356:Vmn1r203	APN	13	22524777	missense	probably damaging	1.00
IGL01527:Vmn1r203	APN	13	22524277	missense	possibly damaging	0.89
IGL01808:Vmn1r203	APN	13	22524547	missense	probably benign	0.02
IGL01887:Vmn1r203	APN	13	22524876	missense	probably benign	0.00
IGL02340:Vmn1r203	APN	13	22524827	nonsense	probably null
IGL02543:Vmn1r203	APN	13	22524904	missense	probably damaging	1.00
IGL02684:Vmn1r203	APN	13	22524369	missense	possibly damaging	0.95
BB005:Vmn1r203	UTSW	13	22524535	missense	probably benign	0.01
BB015:Vmn1r203	UTSW	13	22524535	missense	probably benign	0.01
PIT4519001:Vmn1r203	UTSW	13	22524595	missense	probably benign	0.01
R0544:Vmn1r203	UTSW	13	22524273	missense	possibly damaging	0.94
R1365:Vmn1r203	UTSW	13	22524586	missense	probably benign	0.00
R1396:Vmn1r203	UTSW	13	22524508	missense	probably benign	0.01
R1794:Vmn1r203	UTSW	13	22524351	missense	probably damaging	1.00
R2010:Vmn1r203	UTSW	13	22524447	missense	possibly damaging	0.56
R2169:Vmn1r203	UTSW	13	22524735	nonsense	probably null
R2418:Vmn1r203	UTSW	13	22524834	missense	possibly damaging	0.57
R2419:Vmn1r203	UTSW	13	22524834	missense	possibly damaging	0.57
R4322:Vmn1r203	UTSW	13	22524238	missense	probably damaging	1.00
R4460:Vmn1r203	UTSW	13	22524682	missense	probably damaging	0.98
R4686:Vmn1r203	UTSW	13	22524358	missense	probably damaging	1.00
R5526:Vmn1r203	UTSW	13	22524103	missense	probably benign	0.01
R6240:Vmn1r203	UTSW	13	22524729	missense	possibly damaging	0.89
R6607:Vmn1r203	UTSW	13	22524721	missense	probably benign	0.23
R7575:Vmn1r203	UTSW	13	22524418	missense	probably benign	0.12
R7928:Vmn1r203	UTSW	13	22524535	missense	probably benign	0.01
R8375:Vmn1r203	UTSW	13	22524984	makesense	probably null
R8421:Vmn1r203	UTSW	13	22524984	makesense	probably null
R8424:Vmn1r203	UTSW	13	22524834	missense	probably damaging	1.00
R8845:Vmn1r203	UTSW	13	22524550	missense	possibly damaging	0.81
R8933:Vmn1r203	UTSW	13	22524521	missense	possibly damaging	0.69
R8956:Vmn1r203	UTSW	13	22524834	missense	possibly damaging	0.57
R9493:Vmn1r203	UTSW	13	22524253	missense	probably damaging	1.00
Z1177:Vmn1r203	UTSW	13	22524409	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCAGAACTCCAAGCTTCTCTACAG -3'
(R):5'- TCTCAGATCAAGGGTGTGAAAC -3'

Sequencing Primer
(F):5'- AGAACTCCCCCTGAGCTGAGAG -3'
(R):5'- GTGTGAAACAATAAGAAGATTGTCTG -3'

Posted On

2014-10-30