Incidental Mutation 'R2334:Slc46a2'
ID246519
Institutional Source Beutler Lab
Gene Symbol Slc46a2
Ensembl Gene ENSMUSG00000028386
Gene Namesolute carrier family 46, member 2
SynonymsLy110, TSO-1C12, 5430429N04Rik, Tscot
Accession Numbers

Genbank: NM_021053

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2334 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59905126-59915056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59914150 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 258 (P258S)
Ref Sequence ENSEMBL: ENSMUSP00000030081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030081
AA Change: P258S

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030081
Gene: ENSMUSG00000028386
AA Change: P258S

DomainStartEndE-ValueType
Pfam:MFS_1 65 424 1.1e-16 PFAM
transmembrane domain 438 460 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: About one-third of homozygotes carrying a reporter allele that results in a small deletion within exon 1 display a slight reduction in total thymocyte yield at 6 weeks of age. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A G 4: 144,528,859 K283R probably damaging Het
Ceacam20 T C 7: 19,971,591 F169S probably damaging Het
Clint1 A G 11: 45,909,028 Q556R probably damaging Het
Cpa5 G A 6: 30,624,606 W148* probably null Het
Cryz C T 3: 154,622,191 A310V probably benign Het
Dlk1 T C 12: 109,453,688 V10A probably damaging Het
Fbxw16 T G 9: 109,438,361 L267F probably benign Het
Frmpd1 T C 4: 45,285,408 S1410P probably damaging Het
Itgb4 A T 11: 115,993,435 I982F probably damaging Het
Lrrfip2 G A 9: 111,219,725 C250Y probably benign Het
Mia3 A G 1: 183,334,402 probably null Het
Mlh3 T A 12: 85,268,077 D445V probably benign Het
Ndst4 T A 3: 125,708,176 N129K possibly damaging Het
Nlrp2 T A 7: 5,337,535 E93D probably benign Het
Olfm3 T A 3: 115,101,959 Y163* probably null Het
Olfr318 A T 11: 58,720,462 Y195* probably null Het
Olfr483 C T 7: 108,103,348 T13I probably benign Het
Pdzph1 A G 17: 58,922,649 S1005P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttn T C 2: 76,725,794 E21962G possibly damaging Het
Unc13a T C 8: 71,634,558 D1515G probably damaging Het
Vmn2r70 T C 7: 85,559,592 N559S probably benign Het
Wwp1 A T 4: 19,662,032 I158K probably benign Het
Other mutations in Slc46a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Slc46a2 APN 4 59911926 nonsense probably null
G5030:Slc46a2 UTSW 4 59913867 missense probably damaging 1.00
R0008:Slc46a2 UTSW 4 59914544 missense probably damaging 1.00
R0047:Slc46a2 UTSW 4 59914392 missense probably damaging 1.00
R0047:Slc46a2 UTSW 4 59914392 missense probably damaging 1.00
R1199:Slc46a2 UTSW 4 59914189 missense probably benign 0.17
R1225:Slc46a2 UTSW 4 59914125 missense probably benign 0.01
R1389:Slc46a2 UTSW 4 59914620 missense probably damaging 1.00
R1965:Slc46a2 UTSW 4 59914249 missense probably damaging 1.00
R4036:Slc46a2 UTSW 4 59913818 missense probably damaging 1.00
R4230:Slc46a2 UTSW 4 59914048 missense probably benign 0.15
R4600:Slc46a2 UTSW 4 59911886 missense probably damaging 1.00
R5851:Slc46a2 UTSW 4 59913906 missense probably damaging 1.00
R6467:Slc46a2 UTSW 4 59914077 missense probably benign 0.00
R7213:Slc46a2 UTSW 4 59914279 missense possibly damaging 0.71
R7536:Slc46a2 UTSW 4 59914141 nonsense probably null
R7986:Slc46a2 UTSW 4 59911858 missense probably benign 0.11
R8377:Slc46a2 UTSW 4 59914713 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTATGTACCCAGAAGCCATCCC -3'
(R):5'- GCAAATCGTTGGGCACTCTG -3'

Sequencing Primer
(F):5'- CACTTGGTTCCAATGGAGAGGC -3'
(R):5'- GCGCAAGGCCTCCTGTTAAC -3'
Posted On2014-10-30