Incidental Mutation 'R2336:Eprs'
ID246541
Institutional Source Beutler Lab
Gene Symbol Eprs
Ensembl Gene ENSMUSG00000026615
Gene Nameglutamyl-prolyl-tRNA synthetase
Synonyms2410081F06Rik, 3010002K18Rik, Qprs
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2336 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location185363044-185428360 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 185411374 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046514]
Predicted Effect probably benign
Transcript: ENSMUST00000046514
SMART Domains Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615

DomainStartEndE-ValueType
Pfam:GST_C_3 71 156 2.1e-15 PFAM
Pfam:GST_C 72 157 2.9e-7 PFAM
Pfam:tRNA-synt_1c 197 502 8.8e-127 PFAM
Pfam:tRNA-synt_1c_C 504 681 4.4e-42 PFAM
WHEP-TRS 753 815 1.26e-25 SMART
WHEP-TRS 826 888 1.47e-26 SMART
WHEP-TRS 904 966 3.76e-24 SMART
low complexity region 984 1011 N/A INTRINSIC
Pfam:tRNA-synt_2b 1107 1287 3.1e-17 PFAM
Pfam:HGTP_anticodon 1303 1404 1.7e-19 PFAM
ProRS-C_1 1430 1512 5.27e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192284
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Eprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Eprs APN 1 185407148 missense probably benign 0.11
IGL00532:Eprs APN 1 185407148 missense probably benign 0.11
IGL00543:Eprs APN 1 185407148 missense probably benign 0.11
IGL00553:Eprs APN 1 185407148 missense probably benign 0.11
IGL00574:Eprs APN 1 185407148 missense probably benign 0.11
IGL00583:Eprs APN 1 185407148 missense probably benign 0.11
IGL00946:Eprs APN 1 185407701 missense probably benign 0.02
IGL01062:Eprs APN 1 185379615 missense probably benign 0.19
IGL01477:Eprs APN 1 185411375 splice site probably benign
IGL01608:Eprs APN 1 185385114 unclassified probably benign
IGL01767:Eprs APN 1 185384915 missense probably damaging 0.98
IGL02136:Eprs APN 1 185384983 missense probably damaging 1.00
IGL02302:Eprs APN 1 185387124 splice site probably benign
IGL02528:Eprs APN 1 185413489 missense probably damaging 1.00
IGL02631:Eprs APN 1 185427898 missense probably damaging 1.00
IGL02989:Eprs APN 1 185418366 missense probably benign 0.31
IGL03004:Eprs APN 1 185381833 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0179:Eprs UTSW 1 185413547 missense probably benign
R0783:Eprs UTSW 1 185398458 missense probably damaging 1.00
R1319:Eprs UTSW 1 185384962 missense probably damaging 1.00
R1335:Eprs UTSW 1 185387089 missense probably damaging 1.00
R1514:Eprs UTSW 1 185381834 missense probably damaging 0.99
R1590:Eprs UTSW 1 185401510 missense probably damaging 1.00
R1688:Eprs UTSW 1 185384896 missense probably damaging 0.99
R1725:Eprs UTSW 1 185406992 missense probably damaging 1.00
R2182:Eprs UTSW 1 185379742 splice site probably null
R2228:Eprs UTSW 1 185367537 missense probably damaging 1.00
R2338:Eprs UTSW 1 185415808 missense probably damaging 1.00
R2439:Eprs UTSW 1 185379742 splice site probably null
R2914:Eprs UTSW 1 185379742 splice site probably null
R3001:Eprs UTSW 1 185424391 critical splice donor site probably null
R3002:Eprs UTSW 1 185424391 critical splice donor site probably null
R3003:Eprs UTSW 1 185424391 critical splice donor site probably null
R3547:Eprs UTSW 1 185379742 splice site probably null
R3775:Eprs UTSW 1 185373008 missense probably damaging 1.00
R3878:Eprs UTSW 1 185415953 critical splice donor site probably null
R3902:Eprs UTSW 1 185379742 splice site probably null
R3913:Eprs UTSW 1 185379742 splice site probably null
R4579:Eprs UTSW 1 185401607 missense probably damaging 1.00
R4664:Eprs UTSW 1 185373076 intron probably benign
R4680:Eprs UTSW 1 185386278 missense possibly damaging 0.87
R4712:Eprs UTSW 1 185428108 missense probably benign 0.00
R4749:Eprs UTSW 1 185396130 missense probably damaging 0.97
R4995:Eprs UTSW 1 185410139 intron probably benign
R5154:Eprs UTSW 1 185413465 missense probably damaging 1.00
R5640:Eprs UTSW 1 185374184 missense probably benign 0.34
R5662:Eprs UTSW 1 185394425 missense possibly damaging 0.72
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6151:Eprs UTSW 1 185407754 critical splice donor site probably null
R6387:Eprs UTSW 1 185387084 missense possibly damaging 0.94
R6647:Eprs UTSW 1 185414424 missense probably damaging 1.00
R6701:Eprs UTSW 1 185370890 missense probably damaging 0.99
R6997:Eprs UTSW 1 185396163 missense possibly damaging 0.50
R7295:Eprs UTSW 1 185418210 critical splice acceptor site probably null
R7305:Eprs UTSW 1 185379701 missense probably damaging 1.00
R7729:Eprs UTSW 1 185413169 missense probably damaging 1.00
R7732:Eprs UTSW 1 185372939 missense probably benign 0.01
R7733:Eprs UTSW 1 185397161 missense probably benign
R7826:Eprs UTSW 1 185406968 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTCATCACAAAGTCCGAGATG -3'
(R):5'- TCCAGTCAGAGGACATGAATAGC -3'

Sequencing Primer
(F):5'- AATACTACGATGTGAGTGGCTGC -3'
(R):5'- CAACCAAACTTGCTATAAGGGTAG -3'
Posted On2014-10-30