Incidental Mutation 'R2336:Prokr2'
ID246544
Institutional Source Beutler Lab
Gene Symbol Prokr2
Ensembl Gene ENSMUSG00000050558
Gene Nameprokineticin receptor 2
SynonymsGpcr73l1, B830005M06Rik, PKR2, EG-VEGRF2, Gpr73l1
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R2336 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132337733-132385447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132381439 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 61 (M61K)
Ref Sequence ENSEMBL: ENSMUSP00000105785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049997] [ENSMUST00000110156] [ENSMUST00000110157] [ENSMUST00000142766] [ENSMUST00000145995]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049997
AA Change: M61K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056659
Gene: ENSMUSG00000050558
AA Change: M61K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 61 349 3.3e-7 PFAM
Pfam:7tm_1 67 330 8.2e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110156
AA Change: M61K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105784
Gene: ENSMUSG00000050558
AA Change: M61K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 61 349 3.3e-7 PFAM
Pfam:7tm_1 67 330 1.7e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110157
AA Change: M61K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105785
Gene: ENSMUSG00000050558
AA Change: M61K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 61 153 5.2e-7 PFAM
Pfam:7tm_1 67 155 1.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142766
SMART Domains Protein: ENSMUSP00000124526
Gene: ENSMUSG00000050558

DomainStartEndE-ValueType
Pfam:7tm_1 1 169 4.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145995
Meta Mutation Damage Score 0.8145 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prokineticins are secreted proteins that can promote angiogenesis and induce strong gastrointestinal smooth muscle contraction. The protein encoded by this gene is an integral membrane protein and G protein-coupled receptor for prokineticins. The encoded protein is similar in sequence to GPR73, another G protein-coupled receptor for prokineticins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show 50% neonatal lethality, olfactory bulb malformation, and reproductive system atrophy related to a lack of hypothalamic gonadotropin-releasing hormone synthesizing neurons. Homozygotes for another null allele show impaired circadian behavior and thermoregulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Prokr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Prokr2 APN 2 132381504 missense probably benign 0.28
IGL01948:Prokr2 APN 2 132373683 missense probably damaging 0.97
IGL02930:Prokr2 APN 2 132373474 missense probably benign 0.00
R0092:Prokr2 UTSW 2 132373597 missense probably damaging 1.00
R0717:Prokr2 UTSW 2 132381334 missense probably damaging 1.00
R1547:Prokr2 UTSW 2 132373602 missense probably damaging 1.00
R1573:Prokr2 UTSW 2 132373764 missense probably damaging 0.99
R2302:Prokr2 UTSW 2 132381184 missense probably damaging 1.00
R2483:Prokr2 UTSW 2 132381175 missense probably damaging 1.00
R4049:Prokr2 UTSW 2 132381494 missense probably benign 0.16
R4518:Prokr2 UTSW 2 132374092 critical splice acceptor site probably null
R4947:Prokr2 UTSW 2 132373653 missense probably damaging 1.00
R5961:Prokr2 UTSW 2 132373675 missense possibly damaging 0.95
R5997:Prokr2 UTSW 2 132381442 missense probably damaging 0.99
R6333:Prokr2 UTSW 2 132373978 missense probably damaging 0.98
R6543:Prokr2 UTSW 2 132373899 missense probably benign 0.13
R6599:Prokr2 UTSW 2 132373549 missense possibly damaging 0.92
R6623:Prokr2 UTSW 2 132373574 missense probably damaging 1.00
R7092:Prokr2 UTSW 2 132381316 missense possibly damaging 0.88
R7252:Prokr2 UTSW 2 132381440 missense probably benign 0.03
R7736:Prokr2 UTSW 2 132381580 nonsense probably null
R7767:Prokr2 UTSW 2 132374076 missense probably damaging 1.00
Z1177:Prokr2 UTSW 2 132373665 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CGTACGAAGGTAGTTGACGG -3'
(R):5'- AGCATCATCAACATGGGACC -3'

Sequencing Primer
(F):5'- AAGCACGTGACCATGCG -3'
(R):5'- CCCAGAACAGAAACACTAGCTTTG -3'
Posted On2014-10-30