Incidental Mutation 'R2336:Mttp'
ID246546
Institutional Source Beutler Lab
Gene Symbol Mttp
Ensembl Gene ENSMUSG00000028158
Gene Namemicrosomal triglyceride transfer protein
Synonyms1810043K16Rik, MTP
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R2336 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138089854-138144968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138116095 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 222 (I222K)
Ref Sequence ENSEMBL: ENSMUSP00000029805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029805
AA Change: I222K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158
AA Change: I222K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LPD_N 28 579 8.87e-165 SMART
Blast:LPD_N 582 695 4e-58 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000098580
AA Change: I237K

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158
AA Change: I237K

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LPD_N 43 594 8.87e-165 SMART
Blast:LPD_N 597 710 6e-58 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196625
Meta Mutation Damage Score 0.5307 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Mttp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Mttp APN 3 138109015 missense possibly damaging 0.84
IGL00983:Mttp APN 3 138115129 splice site probably benign
IGL01128:Mttp APN 3 138133997 splice site probably null
IGL01607:Mttp APN 3 138104698 missense probably damaging 0.99
IGL01760:Mttp APN 3 138111736 missense probably benign 0.00
IGL01947:Mttp APN 3 138107129 missense probably damaging 1.00
IGL02184:Mttp APN 3 138116000 critical splice donor site probably null
IGL02932:Mttp APN 3 138111744 missense probably benign 0.07
IGL02957:Mttp APN 3 138109081 missense possibly damaging 0.95
IGL03082:Mttp APN 3 138123795 missense probably benign 0.01
IGL03302:Mttp APN 3 138104707 missense possibly damaging 0.90
IGL03381:Mttp APN 3 138104943 missense probably damaging 1.00
P0040:Mttp UTSW 3 138112566 missense possibly damaging 0.82
R0543:Mttp UTSW 3 138111696 missense possibly damaging 0.75
R0738:Mttp UTSW 3 138103313 missense probably damaging 1.00
R0967:Mttp UTSW 3 138092723 missense probably benign 0.00
R1281:Mttp UTSW 3 138107219 missense possibly damaging 0.95
R1565:Mttp UTSW 3 138116405 critical splice donor site probably null
R1660:Mttp UTSW 3 138103193 missense probably damaging 1.00
R1828:Mttp UTSW 3 138107280 missense probably damaging 1.00
R1886:Mttp UTSW 3 138092615 missense probably damaging 1.00
R1912:Mttp UTSW 3 138116027 missense probably benign 0.01
R1938:Mttp UTSW 3 138125121 missense probably benign 0.21
R2020:Mttp UTSW 3 138118402 missense probably damaging 0.98
R2109:Mttp UTSW 3 138095002 missense probably benign 0.27
R2392:Mttp UTSW 3 138095021 missense probably damaging 0.98
R3021:Mttp UTSW 3 138111703 missense probably benign
R3774:Mttp UTSW 3 138114263 intron probably null
R3776:Mttp UTSW 3 138114263 intron probably null
R4687:Mttp UTSW 3 138092735 missense possibly damaging 0.66
R4708:Mttp UTSW 3 138134098 unclassified probably benign
R4756:Mttp UTSW 3 138116071 missense possibly damaging 0.77
R4832:Mttp UTSW 3 138116050 missense probably benign
R5377:Mttp UTSW 3 138105029 missense probably benign 0.03
R5670:Mttp UTSW 3 138125113 missense probably damaging 0.99
R6613:Mttp UTSW 3 138109078 missense probably damaging 1.00
R6725:Mttp UTSW 3 138107238 missense probably damaging 1.00
R6799:Mttp UTSW 3 138095080 missense probably benign 0.04
R6920:Mttp UTSW 3 138115282 missense possibly damaging 0.49
R7074:Mttp UTSW 3 138107273 missense possibly damaging 0.53
R7131:Mttp UTSW 3 138116132 missense probably benign 0.13
R7275:Mttp UTSW 3 138123785 missense probably benign 0.19
R7291:Mttp UTSW 3 138091203 missense probably damaging 1.00
R7310:Mttp UTSW 3 138095022 missense probably damaging 1.00
R7769:Mttp UTSW 3 138103112 missense probably damaging 1.00
R7909:Mttp UTSW 3 138118417 nonsense probably null
R7990:Mttp UTSW 3 138118417 nonsense probably null
R8037:Mttp UTSW 3 138091122 missense probably damaging 1.00
Z1176:Mttp UTSW 3 138104779 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCGAAATGAAAAGGCCCTCTG -3'
(R):5'- GCGCCACATCAACAGATATTTC -3'

Sequencing Primer
(F):5'- AAAAGGCCCTCTGTGCGC -3'
(R):5'- GCCACATCAACAGATATTTCAGTGTG -3'
Posted On2014-10-30