Incidental Mutation 'R2336:Zfp868'
ID246552
Institutional Source Beutler Lab
Gene Symbol Zfp868
Ensembl Gene ENSMUSG00000060427
Gene Namezinc finger protein 868
Synonyms
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R2336 (G1)
Quality Score209
Status Validated
Chromosome8
Chromosomal Location69610857-69625548 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 69613907 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074982] [ENSMUST00000121886]
Predicted Effect probably null
Transcript: ENSMUST00000074982
SMART Domains Protein: ENSMUSP00000074510
Gene: ENSMUSG00000060427

DomainStartEndE-ValueType
KRAB 16 73 1.37e-12 SMART
low complexity region 83 94 N/A INTRINSIC
ZnF_C2H2 155 177 1.06e-4 SMART
ZnF_C2H2 183 205 1.1e-2 SMART
ZnF_C2H2 211 233 7.78e-3 SMART
ZnF_C2H2 239 261 1.36e-2 SMART
ZnF_C2H2 266 288 2.75e-3 SMART
ZnF_C2H2 294 316 4.79e-3 SMART
ZnF_C2H2 322 344 3.89e-3 SMART
ZnF_C2H2 350 372 5.5e-3 SMART
ZnF_C2H2 378 400 3.21e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121886
SMART Domains Protein: ENSMUSP00000113952
Gene: ENSMUSG00000060427

DomainStartEndE-ValueType
KRAB 16 73 1.37e-12 SMART
low complexity region 83 94 N/A INTRINSIC
ZnF_C2H2 155 177 1.06e-4 SMART
ZnF_C2H2 183 205 1.1e-2 SMART
ZnF_C2H2 211 233 7.78e-3 SMART
ZnF_C2H2 239 261 1.36e-2 SMART
ZnF_C2H2 266 288 2.75e-3 SMART
ZnF_C2H2 294 316 4.79e-3 SMART
ZnF_C2H2 322 344 3.89e-3 SMART
ZnF_C2H2 350 372 5.5e-3 SMART
ZnF_C2H2 378 400 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150118
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Other mutations in Zfp868
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03166:Zfp868 APN 8 69612314 missense probably damaging 0.99
R0546:Zfp868 UTSW 8 69612231 missense probably benign 0.00
R1706:Zfp868 UTSW 8 69612409 missense probably benign 0.27
R1741:Zfp868 UTSW 8 69611868 missense probably damaging 1.00
R2119:Zfp868 UTSW 8 69611995 nonsense probably null
R3161:Zfp868 UTSW 8 69612085 missense probably benign 0.01
R5847:Zfp868 UTSW 8 69611652 missense probably damaging 1.00
R6361:Zfp868 UTSW 8 69611913 missense probably damaging 1.00
R6753:Zfp868 UTSW 8 69612096 missense probably benign 0.08
R6855:Zfp868 UTSW 8 69611579 missense probably damaging 1.00
Z1088:Zfp868 UTSW 8 69611910 frame shift probably null
Z1176:Zfp868 UTSW 8 69612324 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CCGACAACCAGAAATACTTGTTCTC -3'
(R):5'- AGCAGTGCATCTCTTCCCTG -3'

Sequencing Primer
(F):5'- TCCTGAACTCACTATGTAGAGAGGC -3'
(R):5'- ATCTCTTCCCTGGACGCAG -3'
Posted On2014-10-30