Incidental Mutation 'R2336:Grik4'
ID246553
Institutional Source Beutler Lab
Gene Symbol Grik4
Ensembl Gene ENSMUSG00000032017
Gene Nameglutamate receptor, ionotropic, kainate 4
Synonyms6330551K01Rik, GluRgamma1, KA-1, KA1
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2336 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42518135-42944493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42566355 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 512 (D512N)
Ref Sequence ENSEMBL: ENSMUSP00000110515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034515] [ENSMUST00000114865]
Predicted Effect probably damaging
Transcript: ENSMUST00000034515
AA Change: D512N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034515
Gene: ENSMUSG00000032017
AA Change: D512N

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 2.7e-60 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114865
AA Change: D512N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110515
Gene: ENSMUSG00000032017
AA Change: D512N

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 5.1e-66 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced GYKI-resistant excitatory postsynaptic current. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Grik4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Grik4 APN 9 42521176 missense probably damaging 0.99
IGL01929:Grik4 APN 9 42566298 critical splice donor site probably null
IGL02049:Grik4 APN 9 42543753 splice site probably benign
IGL02331:Grik4 APN 9 42541988 missense probably damaging 1.00
IGL02652:Grik4 APN 9 42675277 missense possibly damaging 0.94
IGL02817:Grik4 APN 9 42622939 missense probably benign 0.00
IGL02945:Grik4 APN 9 42597879 missense possibly damaging 0.92
IGL03100:Grik4 APN 9 42550455 missense probably damaging 0.99
IGL03168:Grik4 APN 9 42671243 missense probably damaging 1.00
R0420:Grik4 UTSW 9 42622096 nonsense probably null
R0894:Grik4 UTSW 9 42688109 splice site probably benign
R1458:Grik4 UTSW 9 42521122 missense probably benign 0.21
R1502:Grik4 UTSW 9 42520873 missense probably damaging 0.97
R1502:Grik4 UTSW 9 42591447 missense probably benign 0.03
R1808:Grik4 UTSW 9 42629026 missense probably benign 0.19
R1945:Grik4 UTSW 9 42521004 missense possibly damaging 0.79
R2180:Grik4 UTSW 9 42542005 missense probably benign 0.45
R2203:Grik4 UTSW 9 42547655 missense probably damaging 1.00
R2508:Grik4 UTSW 9 42622142 missense probably damaging 1.00
R2890:Grik4 UTSW 9 42671219 missense probably damaging 1.00
R3702:Grik4 UTSW 9 42675218 missense probably damaging 0.97
R3834:Grik4 UTSW 9 42629123 missense probably benign 0.04
R4082:Grik4 UTSW 9 42597884 missense probably benign 0.00
R4604:Grik4 UTSW 9 42524586 missense probably damaging 1.00
R4711:Grik4 UTSW 9 42629093 missense probably damaging 1.00
R5417:Grik4 UTSW 9 42671248 missense probably benign 0.45
R5540:Grik4 UTSW 9 42520947 missense probably damaging 0.99
R5680:Grik4 UTSW 9 42629119 missense probably benign
R5740:Grik4 UTSW 9 42808567 missense possibly damaging 0.88
R5876:Grik4 UTSW 9 42688023 missense probably damaging 1.00
R5911:Grik4 UTSW 9 42591424 missense probably damaging 1.00
R6319:Grik4 UTSW 9 42566336 missense probably damaging 1.00
R6475:Grik4 UTSW 9 42629008 missense probably benign 0.01
R6544:Grik4 UTSW 9 42547728 nonsense probably null
R7065:Grik4 UTSW 9 42543831 missense probably damaging 1.00
R7278:Grik4 UTSW 9 42622060 missense probably benign 0.25
X0028:Grik4 UTSW 9 42675227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGCCCAGCGCATTTGC -3'
(R):5'- AGAAAACATGGATCCCAGCTTC -3'

Sequencing Primer
(F):5'- TAGCCCAGCGCATTTGCATTTAAG -3'
(R):5'- TCCACATGGGTCCTTCTGAGAG -3'
Posted On2014-10-30