Incidental Mutation 'R2336:Usp43'
ID246556
Institutional Source Beutler Lab
Gene Symbol Usp43
Ensembl Gene ENSMUSG00000020905
Gene Nameubiquitin specific peptidase 43
Synonyms
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2336 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67854523-67922153 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 67891432 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 387 (R387*)
Ref Sequence ENSEMBL: ENSMUSP00000104317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021288] [ENSMUST00000108677]
Predicted Effect probably null
Transcript: ENSMUST00000021288
AA Change: R387*
SMART Domains Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905
AA Change: R387*

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 707 2.8e-61 PFAM
Pfam:UCH_1 101 297 1.3e-6 PFAM
Pfam:UCH_1 503 689 5.2e-13 PFAM
low complexity region 717 731 N/A INTRINSIC
low complexity region 958 972 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108677
AA Change: R387*
SMART Domains Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905
AA Change: R387*

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 702 3.5e-54 PFAM
Pfam:UCH_1 101 298 2.7e-7 PFAM
Pfam:UCH_1 503 684 1.2e-9 PFAM
low complexity region 712 726 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Usp43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Usp43 APN 11 67891419 missense probably benign 0.08
IGL01536:Usp43 APN 11 67855938 missense probably benign 0.01
IGL01754:Usp43 APN 11 67856181 missense probably benign 0.06
IGL02057:Usp43 APN 11 67856287 missense probably benign 0.02
IGL02638:Usp43 APN 11 67855755 missense probably benign 0.06
IGL03105:Usp43 APN 11 67879976 missense possibly damaging 0.82
IGL03155:Usp43 APN 11 67876489 missense probably damaging 1.00
IGL03380:Usp43 APN 11 67875316 missense possibly damaging 0.67
R0207:Usp43 UTSW 11 67876499 missense probably damaging 1.00
R0308:Usp43 UTSW 11 67880140 missense probably damaging 1.00
R0350:Usp43 UTSW 11 67876498 missense probably damaging 1.00
R0479:Usp43 UTSW 11 67897274 missense possibly damaging 0.96
R1451:Usp43 UTSW 11 67856181 missense probably benign 0.01
R1686:Usp43 UTSW 11 67887767 missense probably damaging 0.99
R1750:Usp43 UTSW 11 67879953 missense probably damaging 1.00
R1956:Usp43 UTSW 11 67904333 missense probably damaging 1.00
R2107:Usp43 UTSW 11 67855740 frame shift probably null
R2108:Usp43 UTSW 11 67855740 frame shift probably null
R2112:Usp43 UTSW 11 67921710 missense probably damaging 1.00
R2162:Usp43 UTSW 11 67879969 missense probably damaging 1.00
R4031:Usp43 UTSW 11 67913833 missense probably damaging 1.00
R4355:Usp43 UTSW 11 67891464 missense probably benign 0.01
R4410:Usp43 UTSW 11 67855890 missense probably benign 0.00
R4479:Usp43 UTSW 11 67856407 missense possibly damaging 0.96
R4569:Usp43 UTSW 11 67875352 nonsense probably null
R4569:Usp43 UTSW 11 67898962 missense probably damaging 1.00
R4737:Usp43 UTSW 11 67855505 missense probably damaging 1.00
R5395:Usp43 UTSW 11 67897358 critical splice acceptor site probably null
R5466:Usp43 UTSW 11 67913883 missense probably damaging 0.99
R5686:Usp43 UTSW 11 67921916 unclassified probably benign
R6106:Usp43 UTSW 11 67879907 missense probably benign 0.00
R7205:Usp43 UTSW 11 67883284 missense probably null 1.00
R7360:Usp43 UTSW 11 67876329 splice site probably null
R7426:Usp43 UTSW 11 67893016 missense possibly damaging 0.60
R7755:Usp43 UTSW 11 67891468 missense possibly damaging 0.94
R7937:Usp43 UTSW 11 67855789 missense probably damaging 0.96
R8054:Usp43 UTSW 11 67891458 missense probably damaging 0.96
R8410:Usp43 UTSW 11 67856320 missense probably damaging 1.00
R8792:Usp43 UTSW 11 67876418 nonsense probably null
R8865:Usp43 UTSW 11 67898962 missense probably damaging 1.00
Z1088:Usp43 UTSW 11 67856040 missense probably benign 0.39
Z1176:Usp43 UTSW 11 67921841 missense unknown
Z1177:Usp43 UTSW 11 67855808 missense possibly damaging 0.56
Z1177:Usp43 UTSW 11 67922032 missense unknown
Z1186:Usp43 UTSW 11 67855719 small insertion probably benign
Z1186:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1187:Usp43 UTSW 11 67855719 small insertion probably benign
Z1187:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1188:Usp43 UTSW 11 67855719 small insertion probably benign
Z1188:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1189:Usp43 UTSW 11 67855719 small insertion probably benign
Z1189:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1190:Usp43 UTSW 11 67855719 small insertion probably benign
Z1190:Usp43 UTSW 11 67855723 small insertion probably benign
Z1190:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1191:Usp43 UTSW 11 67855719 small insertion probably benign
Z1191:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1192:Usp43 UTSW 11 67855719 small insertion probably benign
Z1192:Usp43 UTSW 11 67856506 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACAGCTAATCCTCTTGCTCAG -3'
(R):5'- TCTTCTAATCAAACTCAGGCCC -3'

Sequencing Primer
(F):5'- CCTGAGGCAGTCTTGGTTACAAAG -3'
(R):5'- CAGGCCCATCTTTTAAAATTATTGGC -3'
Posted On2014-10-30