Mutagenetix > Incidental Mutation

Incidental Mutation 'R2336:Usp43'

246556

Institutional Source

Beutler Lab

Gene Symbol

Usp43

Ensembl Gene

ENSMUSG00000020905

Gene Name

ubiquitin specific peptidase 43

Synonyms

MMRRC Submission

040323-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2336 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67854523-67922153 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 67891432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 387 (R387*)

Ref Sequence

ENSEMBL: ENSMUSP00000104317 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021288] [ENSMUST00000108677]

AlphaFold

Q8BUM9

Predicted Effect

probably null
Transcript: ENSMUST00000021288
AA Change: R387*

SMART Domains

Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905
AA Change: R387*

Domain	Start	End	E-Value	Type
low complexity region	8	54	N/A	INTRINSIC
low complexity region	59	87	N/A	INTRINSIC
Pfam:UCH	100	707	2.8e-61	PFAM
Pfam:UCH_1	101	297	1.3e-6	PFAM
Pfam:UCH_1	503	689	5.2e-13	PFAM
low complexity region	717	731	N/A	INTRINSIC
low complexity region	958	972	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108677
AA Change: R387*

SMART Domains

Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905
AA Change: R387*

Domain	Start	End	E-Value	Type
low complexity region	8	54	N/A	INTRINSIC
low complexity region	59	87	N/A	INTRINSIC
Pfam:UCH	100	702	3.5e-54	PFAM
Pfam:UCH_1	101	298	2.7e-7	PFAM
Pfam:UCH_1	503	684	1.2e-9	PFAM
low complexity region	712	726	N/A	INTRINSIC
low complexity region	953	967	N/A	INTRINSIC

Meta Mutation Damage Score

0.9711

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	T	A	1: 181,227,641		noncoding transcript	Het
Arhgap21	G	A	2: 20,880,051	R772C	probably damaging	Het
Arid2	A	G	15: 96,362,549	E393G	probably damaging	Het
Atrn	C	T	2: 130,957,954	T417I	probably damaging	Het
Baiap3	T	C	17: 25,250,404	K173R	probably damaging	Het
Bdp1	A	T	13: 100,053,002	N1497K	probably damaging	Het
Ceacam5	T	C	7: 17,747,375	V349A	probably benign	Het
Chrnd	T	C	1: 87,194,893	F132S	probably damaging	Het
Ddx42	A	G	11: 106,231,150	M164V	possibly damaging	Het
Dtwd2	A	G	18: 49,700,253		probably benign	Het
Eprs	T	A	1: 185,411,374		probably benign	Het
Fut8	A	G	12: 77,412,956		probably benign	Het
Gabrr3	C	T	16: 59,429,950	T104M	probably damaging	Het
Gcat	G	A	15: 79,030,980	R16H	probably benign	Het
Gnb2	A	T	5: 137,529,198	W125R	probably damaging	Het
Grik4	C	T	9: 42,566,355	D512N	probably damaging	Het
Hnf4g	T	C	3: 3,641,224	F60L	probably benign	Het
Lrp6	A	G	6: 134,507,583	I359T	probably damaging	Het
Lrrfip2	A	G	9: 111,222,215	D325G	probably damaging	Het
Mttp	A	T	3: 138,116,095	I222K	possibly damaging	Het
Myom1	A	T	17: 71,023,194	H107L	possibly damaging	Het
Olfr120	A	T	17: 37,726,798	Y258F	probably benign	Het
Olfr458	A	G	6: 42,460,729	C97R	probably damaging	Het
Ppfia3	T	C	7: 45,356,697		probably null	Het
Prokr2	A	T	2: 132,381,439	M61K	probably damaging	Het
Ptk2	A	G	15: 73,266,116	C502R	probably damaging	Het
Rbm25	T	A	12: 83,651,418	W172R	probably damaging	Het
Rdh16f1	A	G	10: 127,788,755	K154R	probably benign	Het
Rnf213	G	A	11: 119,414,604	E554K	probably benign	Het
Rnf219	G	A	14: 104,478,882	P685L	probably damaging	Het
St3gal6	A	T	16: 58,493,704	I22K	probably damaging	Het
Vmn2r106	T	C	17: 20,268,208	N643S	probably benign	Het
Zcchc6	G	T	13: 59,799,054	P585Q	probably damaging	Het
Zdbf2	G	T	1: 63,303,464	R334L	probably benign	Het
Zfp868	G	T	8: 69,613,907		probably null	Het

Other mutations in Usp43

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00902:Usp43	APN	11	67891419	missense	probably benign	0.08
IGL01536:Usp43	APN	11	67855938	missense	probably benign	0.01
IGL01754:Usp43	APN	11	67856181	missense	probably benign	0.06
IGL02057:Usp43	APN	11	67856287	missense	probably benign	0.02
IGL02638:Usp43	APN	11	67855755	missense	probably benign	0.06
IGL03105:Usp43	APN	11	67879976	missense	possibly damaging	0.82
IGL03155:Usp43	APN	11	67876489	missense	probably damaging	1.00
IGL03380:Usp43	APN	11	67875316	missense	possibly damaging	0.67
R0207:Usp43	UTSW	11	67876499	missense	probably damaging	1.00
R0308:Usp43	UTSW	11	67880140	missense	probably damaging	1.00
R0350:Usp43	UTSW	11	67876498	missense	probably damaging	1.00
R0479:Usp43	UTSW	11	67897274	missense	possibly damaging	0.96
R1451:Usp43	UTSW	11	67856181	missense	probably benign	0.01
R1686:Usp43	UTSW	11	67887767	missense	probably damaging	0.99
R1750:Usp43	UTSW	11	67879953	missense	probably damaging	1.00
R1956:Usp43	UTSW	11	67904333	missense	probably damaging	1.00
R2107:Usp43	UTSW	11	67855740	frame shift	probably null
R2108:Usp43	UTSW	11	67855740	frame shift	probably null
R2112:Usp43	UTSW	11	67921710	missense	probably damaging	1.00
R2162:Usp43	UTSW	11	67879969	missense	probably damaging	1.00
R4031:Usp43	UTSW	11	67913833	missense	probably damaging	1.00
R4355:Usp43	UTSW	11	67891464	missense	probably benign	0.01
R4410:Usp43	UTSW	11	67855890	missense	probably benign	0.00
R4479:Usp43	UTSW	11	67856407	missense	possibly damaging	0.96
R4569:Usp43	UTSW	11	67875352	nonsense	probably null
R4569:Usp43	UTSW	11	67898962	missense	probably damaging	1.00
R4737:Usp43	UTSW	11	67855505	missense	probably damaging	1.00
R5395:Usp43	UTSW	11	67897358	critical splice acceptor site	probably null
R5466:Usp43	UTSW	11	67913883	missense	probably damaging	0.99
R5686:Usp43	UTSW	11	67921916	unclassified	probably benign
R6106:Usp43	UTSW	11	67879907	missense	probably benign	0.00
R7205:Usp43	UTSW	11	67883284	missense	probably null	1.00
R7360:Usp43	UTSW	11	67876329	splice site	probably null
R7426:Usp43	UTSW	11	67893016	missense	possibly damaging	0.60
R7755:Usp43	UTSW	11	67891468	missense	possibly damaging	0.94
R7937:Usp43	UTSW	11	67855789	missense	probably damaging	0.96
R8054:Usp43	UTSW	11	67891458	missense	probably damaging	0.96
R8410:Usp43	UTSW	11	67856320	missense	probably damaging	1.00
R8792:Usp43	UTSW	11	67876418	nonsense	probably null
R8865:Usp43	UTSW	11	67898962	missense	probably damaging	1.00
R8879:Usp43	UTSW	11	67898881	splice site	probably benign
R8906:Usp43	UTSW	11	67891481	missense	possibly damaging	0.51
R9287:Usp43	UTSW	11	67880096	missense	probably damaging	0.98
R9303:Usp43	UTSW	11	67876519	missense	probably damaging	1.00
R9305:Usp43	UTSW	11	67876519	missense	probably damaging	1.00
Z1088:Usp43	UTSW	11	67856040	missense	probably benign	0.39
Z1176:Usp43	UTSW	11	67921841	missense	unknown
Z1177:Usp43	UTSW	11	67855808	missense	possibly damaging	0.56
Z1177:Usp43	UTSW	11	67922032	missense	unknown
Z1186:Usp43	UTSW	11	67855719	small insertion	probably benign
Z1186:Usp43	UTSW	11	67856506	missense	probably benign	0.41
Z1187:Usp43	UTSW	11	67855719	small insertion	probably benign
Z1187:Usp43	UTSW	11	67856506	missense	probably benign	0.41
Z1188:Usp43	UTSW	11	67855719	small insertion	probably benign
Z1188:Usp43	UTSW	11	67856506	missense	probably benign	0.41
Z1189:Usp43	UTSW	11	67855719	small insertion	probably benign
Z1189:Usp43	UTSW	11	67856506	missense	probably benign	0.41
Z1190:Usp43	UTSW	11	67855719	small insertion	probably benign
Z1190:Usp43	UTSW	11	67855723	small insertion	probably benign
Z1190:Usp43	UTSW	11	67856506	missense	probably benign	0.41
Z1191:Usp43	UTSW	11	67855719	small insertion	probably benign
Z1191:Usp43	UTSW	11	67856506	missense	probably benign	0.41
Z1192:Usp43	UTSW	11	67855719	small insertion	probably benign
Z1192:Usp43	UTSW	11	67856506	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- ACAGCTAATCCTCTTGCTCAG -3'
(R):5'- TCTTCTAATCAAACTCAGGCCC -3'

Sequencing Primer
(F):5'- CCTGAGGCAGTCTTGGTTACAAAG -3'
(R):5'- CAGGCCCATCTTTTAAAATTATTGGC -3'

Posted On

2014-10-30