Incidental Mutation 'R2336:Ddx42'
ID246557
Institutional Source Beutler Lab
Gene Symbol Ddx42
Ensembl Gene ENSMUSG00000020705
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 42
SynonymsB430002H05Rik, SF3b125, 1810047H21Rik
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2336 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106216926-106249139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106231150 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 164 (M164V)
Ref Sequence ENSEMBL: ENSMUSP00000021046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021046
AA Change: M164V

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021046
Gene: ENSMUSG00000020705
AA Change: M164V

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 108 114 N/A INTRINSIC
coiled coil region 116 143 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
DEXDc 272 474 7.61e-68 SMART
HELICc 512 593 1.58e-33 SMART
low complexity region 644 659 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 814 838 N/A INTRINSIC
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Ddx42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ddx42 APN 11 106235749 missense probably damaging 0.98
IGL00833:Ddx42 APN 11 106231178 missense possibly damaging 0.52
IGL01095:Ddx42 APN 11 106247499 missense probably damaging 1.00
IGL01651:Ddx42 APN 11 106248029 missense probably benign 0.00
IGL01715:Ddx42 APN 11 106224275 missense probably damaging 1.00
IGL02097:Ddx42 APN 11 106239160 missense probably benign 0.00
IGL03182:Ddx42 APN 11 106247527 missense probably benign
P0045:Ddx42 UTSW 11 106231272 missense probably damaging 1.00
R0504:Ddx42 UTSW 11 106247849 missense probably benign 0.03
R0646:Ddx42 UTSW 11 106232833 missense probably benign 0.00
R2277:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2279:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2297:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2519:Ddx42 UTSW 11 106245329 missense probably damaging 1.00
R3413:Ddx42 UTSW 11 106247810 missense probably benign 0.00
R3498:Ddx42 UTSW 11 106231193 missense possibly damaging 0.90
R3883:Ddx42 UTSW 11 106247692 missense probably benign 0.03
R4421:Ddx42 UTSW 11 106231138 missense probably damaging 1.00
R4696:Ddx42 UTSW 11 106247703 missense probably benign 0.09
R4953:Ddx42 UTSW 11 106242940 missense probably damaging 1.00
R5398:Ddx42 UTSW 11 106224898 missense probably benign
R5669:Ddx42 UTSW 11 106241819 missense probably damaging 1.00
R6091:Ddx42 UTSW 11 106234970 missense probably damaging 1.00
R6139:Ddx42 UTSW 11 106240017 missense probably damaging 1.00
R6643:Ddx42 UTSW 11 106228820 missense probably benign 0.14
R6991:Ddx42 UTSW 11 106239144 missense probably damaging 1.00
R7351:Ddx42 UTSW 11 106247682 missense probably benign
R7502:Ddx42 UTSW 11 106247739 missense probably benign 0.00
R7792:Ddx42 UTSW 11 106236996 missense probably damaging 1.00
RF018:Ddx42 UTSW 11 106232804 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCACAAACAGGAAGGCTTCTG -3'
(R):5'- GAATTTCTGATCCAACCACTTAGC -3'

Sequencing Primer
(F):5'- ACAGGAAGGCTTCTGTTAAATAAATC -3'
(R):5'- ACCACTTAGCAGAAATAAAGATTCC -3'
Posted On2014-10-30