Incidental Mutation 'R2336:Rbm25'
ID246560
Institutional Source Beutler Lab
Gene Symbol Rbm25
Ensembl Gene ENSMUSG00000010608
Gene NameRNA binding motif protein 25
SynonymsA130095G20Rik, 2610015J01Rik, 2600011C06Rik
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2336 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83631236-83683123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83651418 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 172 (W172R)
Ref Sequence ENSEMBL: ENSMUSP00000138565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048155] [ENSMUST00000181983] [ENSMUST00000182036] [ENSMUST00000182450] [ENSMUST00000182618] [ENSMUST00000182633]
Predicted Effect unknown
Transcript: ENSMUST00000048155
AA Change: W172R
SMART Domains Protein: ENSMUSP00000048470
Gene: ENSMUSG00000010608
AA Change: W172R

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
low complexity region 234 241 N/A INTRINSIC
coiled coil region 270 351 N/A INTRINSIC
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 606 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
PWI 758 831 2.79e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181983
AA Change: W172R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138572
Gene: ENSMUSG00000010608
AA Change: W172R

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
internal_repeat_1 187 203 3e-5 PROSPERO
low complexity region 234 241 N/A INTRINSIC
internal_repeat_1 258 274 3e-5 PROSPERO
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
low complexity region 575 584 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182032
Predicted Effect probably damaging
Transcript: ENSMUST00000182036
AA Change: W172R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138565
Gene: ENSMUSG00000010608
AA Change: W172R

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182255
Predicted Effect possibly damaging
Transcript: ENSMUST00000182450
AA Change: N152K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138416
Gene: ENSMUSG00000010608
AA Change: N152K

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182618
SMART Domains Protein: ENSMUSP00000138665
Gene: ENSMUSG00000010608

DomainStartEndE-ValueType
low complexity region 29 63 N/A INTRINSIC
RRM 107 172 3.44e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182633
AA Change: N171K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138625
Gene: ENSMUSG00000010608
AA Change: N171K

DomainStartEndE-ValueType
low complexity region 29 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183128
Meta Mutation Damage Score 0.8166 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Rbm25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Rbm25 APN 12 83659567 missense probably damaging 1.00
IGL02095:Rbm25 APN 12 83671974 missense probably damaging 1.00
IGL02227:Rbm25 APN 12 83672753 missense probably damaging 1.00
IGL02454:Rbm25 APN 12 83660322 missense probably benign 0.02
IGL02704:Rbm25 APN 12 83642726 missense probably damaging 1.00
IGL02726:Rbm25 APN 12 83672852 missense probably damaging 1.00
IGL03384:Rbm25 APN 12 83659523 missense probably benign 0.28
R0380:Rbm25 UTSW 12 83660356 missense probably benign 0.02
R0829:Rbm25 UTSW 12 83660376 splice site probably benign
R1330:Rbm25 UTSW 12 83677892 missense probably damaging 1.00
R1346:Rbm25 UTSW 12 83644393 splice site probably benign
R1518:Rbm25 UTSW 12 83668445 missense possibly damaging 0.91
R1566:Rbm25 UTSW 12 83675054 missense probably damaging 0.98
R1660:Rbm25 UTSW 12 83668150 unclassified probably benign
R1809:Rbm25 UTSW 12 83672727 splice site probably benign
R2213:Rbm25 UTSW 12 83676082 missense probably benign 0.00
R2943:Rbm25 UTSW 12 83660641 missense probably damaging 1.00
R3971:Rbm25 UTSW 12 83675208 missense probably benign 0.03
R4349:Rbm25 UTSW 12 83675173 missense probably damaging 0.99
R4740:Rbm25 UTSW 12 83644407 missense possibly damaging 0.61
R4987:Rbm25 UTSW 12 83677856 missense probably damaging 1.00
R5205:Rbm25 UTSW 12 83672869 missense probably benign 0.03
R5579:Rbm25 UTSW 12 83668507 missense probably benign 0.41
R5603:Rbm25 UTSW 12 83664216 nonsense probably null
R5909:Rbm25 UTSW 12 83681588 missense probably damaging 0.97
R5930:Rbm25 UTSW 12 83677866 missense possibly damaging 0.46
R5982:Rbm25 UTSW 12 83671951 missense probably damaging 0.99
R6233:Rbm25 UTSW 12 83659426 missense probably benign 0.24
R6275:Rbm25 UTSW 12 83644432 missense probably damaging 0.98
R6282:Rbm25 UTSW 12 83676089 missense probably damaging 0.98
R7156:Rbm25 UTSW 12 83664191 missense unknown
R7188:Rbm25 UTSW 12 83663998 missense unknown
R7217:Rbm25 UTSW 12 83664217 missense unknown
R7403:Rbm25 UTSW 12 83676134 missense probably damaging 1.00
R7508:Rbm25 UTSW 12 83672877 missense probably damaging 0.99
R7703:Rbm25 UTSW 12 83675090 missense possibly damaging 0.69
R8004:Rbm25 UTSW 12 83674392 missense possibly damaging 0.61
Z1176:Rbm25 UTSW 12 83672884 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGGTGATGACTTCAGTGACC -3'
(R):5'- TTTCATCCCAACCTGGAACAAG -3'

Sequencing Primer
(F):5'- GGTGATGACTTCAGTGACCTCATAAG -3'
(R):5'- CACTGTGGGTAGATAAAACACTTATC -3'
Posted On2014-10-30