Incidental Mutation 'R2336:Gcat'
ID246566
Institutional Source Beutler Lab
Gene Symbol Gcat
Ensembl Gene ENSMUSG00000116378
Gene Name
Synonymsaminoacetone synthase, Kbl
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R2336 (G1)
Quality Score122
Status Validated
Chromosome15
Chromosomal Location79030901-79042531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79030980 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 16 (R16H)
Ref Sequence ENSEMBL: ENSMUSP00000006544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006544] [ENSMUST00000171999] [ENSMUST00000180086]
Predicted Effect probably benign
Transcript: ENSMUST00000006544
AA Change: R16H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000006544
Gene: ENSMUSG00000006378
AA Change: R16H

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 63 405 8.8e-72 PFAM
Pfam:Aminotran_5 77 236 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171999
AA Change: R16H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131649
Gene: ENSMUSG00000116378
AA Change: R16H

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 63 379 2e-64 PFAM
Pfam:Aminotran_5 77 236 4.7e-8 PFAM
Pfam:Cys_Met_Meta_PP 93 240 2.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180086
SMART Domains Protein: ENSMUSP00000137309
Gene: ENSMUSG00000096210

DomainStartEndE-ValueType
H15 22 87 2.82e-27 SMART
low complexity region 108 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230293
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The degradation of L-threonine to glycine consists of a two-step biochemical pathway involving the enzymes L-threonine dehydrogenase and 2-amino-3-ketobutyrate coenzyme A ligase. L-Threonine is first converted into 2-amino-3-ketobutyrate by L-threonine dehydrogenase. This gene encodes the second enzyme in this pathway, which then catalyzes the reaction between 2-amino-3-ketobutyrate and coenzyme A to form glycine and acetyl-CoA. The encoded enzyme is considered a class II pyridoxal-phosphate-dependent aminotransferase. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 14. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Gcat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Gcat APN 15 79034065 splice site probably benign
IGL03238:Gcat APN 15 79036010 splice site probably benign
R1440:Gcat UTSW 15 79033994 missense probably null 1.00
R1696:Gcat UTSW 15 79035795 missense probably damaging 0.98
R3418:Gcat UTSW 15 79042097 missense possibly damaging 0.89
R3890:Gcat UTSW 15 79037176 missense probably damaging 1.00
R3905:Gcat UTSW 15 79043331 missense possibly damaging 0.74
R4653:Gcat UTSW 15 79035287 missense probably damaging 1.00
R4814:Gcat UTSW 15 79031122 critical splice donor site probably null
R5121:Gcat UTSW 15 79035282 missense probably damaging 1.00
R5454:Gcat UTSW 15 79036410 missense probably benign
R5550:Gcat UTSW 15 79042211 missense probably benign 0.30
R5664:Gcat UTSW 15 79043073 missense probably damaging 1.00
R6022:Gcat UTSW 15 79042278 missense probably damaging 0.98
R6419:Gcat UTSW 15 79036064 missense probably damaging 1.00
R6868:Gcat UTSW 15 79035366 missense probably damaging 0.99
R7243:Gcat UTSW 15 79036863 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATCAATCCTTTCTTGGCGGGC -3'
(R):5'- ACATGCAAGCCTTGGAAGGG -3'

Sequencing Primer
(F):5'- CGACGCTGTCAGGCTCC -3'
(R):5'- CAAGCCTTGGAAGGGCTCTTG -3'
Posted On2014-10-30